What was a consequence of the Alien and Sedition Acts?

A) People were banned from becoming members of the Federalist Party.

B) People were forced to serve in the military before they could vote.

C) People went to prison and paid fines for speaking against the government.

D) People from other countries were encouraged to come to the United States.

Answers

Answer 1

Answer:

The answer is C. People wenot to prison and paid fines for speaking against the government.

Explanation:

I took the quiz on K12.

What Was A Consequence Of The Alien And Sedition Acts?A) People Were Banned From Becoming Members Of

Related Questions

No links please. All of the following nations were represented at the Berlin conference except which one? a) Berlin b) Congo c) Portugal b) France

Answers

Answer:

B) Congo

Explanation:

The nations that was represented were:

Austria-Hungary, Belgium, Denmark, France, Germany, Great Britain, Italy, the Netherlands, Portugal, Russia, Spain, Sweden-Norway, Turkey, and the United States of America.

Hope this helps!

Please help!!
No links
Picture is included

Answers

Answer: The answer is C

Explanation: Give me the brainiest

Which is true of Spain during Islamic rule? O A. Jews were persecuted. B. The arts flourished C. Scholarship declined. O D. The arts were discouraged.​

Answers

Answer:

I wanna say A is correct

Explanation:

Name and describe one way the Crusades affected the Christian population.
50 points + brainilest!! <3

Answers

Answer:

Some facts about Christian land to help you. x

The Latin kingdom of Jerusalem established by the Crusaders boasted fifteen cathedral churches. The Church of the Nativity in Bethlehem, for example, became the seat of a Western Christian bishop in 1110 (1988.1174.9). The population of Christians in that area increased and became the most popular religion to follow.

The first man and woman, according to Norse legend, were created from

trees and given the gift of


language

Answers

Answer:

Ask and Embla

Explanation:

Hope this helps!

Before the Constitution could go into effect, __________ of __________ states were required to approve it.
A.
5 . . . 7
B.
9 . . . 13
C.
13 . . . 13
D.
45 . . . 50



Please select the best answer from the choices provided

Answers

Answer:

C. 13 states.

Explanation:

Answer:

its b

Explanation: got it right on test

What is heroism ?.mmm
.

Answers

Heroism consists of putting others first, even at your own peril. As someone who shows great courage and valor is referred to as a hero, their actions are considered to be acts of heroism.

Explanation:

heroic conduct especially as exhibited in fulfilling a high purpose or attaining a noble end. the qualities of a hero.

Paul Revere's print tells the story of
the Boston Massacre from what point
of view?
A. The Royal Governor
B. The colonists involved
C. The British soldiers
D. King George III

Answers

Paul Revere's print tells the story of the Boston Massacre from the point of view of the colonist involved.

What was Paul Revere's view point?

In the Printed paper after British troops opened fire, the Revere's view depict was that it was likely to lit a flame under the Patriot cause and stoked anti-British sentiment throughout the restless colonies.

Hence, the revere's print tells the story of the Boston Massacre from the point of view of the colonist involved.

Therefore, the Option B is correct.

Read more about Boston Massacre

brainly.com/question/7829931

#SPJ1

Answer: the answer to this question is B!

Which is not an invention from the Tang and Song dynasties in China?


porcelain


silk


gunpowder


magnetic compass

Answers

Answer: D.SILK

Explanation: its how it is

Answer:

your answer to this would be: silk i believe

Explanation:

Hope this helps!

the geographical and financial importance of Mewar, Gujarat, Bengal, Kandhar, Bulk, Badakhshan, Golconda

Answers

The northern and eastern portions of Mewar consist of an elevated plateau while the western and southern portions were rocky and hilly with dense forests.

Gujarat is a peninsular state of India and it is surrounded by the Arabian Sea on its three sides. Physio-graphically, it has four geographical regions i.e. The Kathiawar peninsula, the Kachchh peninsula, the Rann of Kachchh and the Gujarat Plain.

Geography of West Bengal which is a state in eastern India, is diverse consist of high peaks of Himalaya in the northern side where Himalayas are located in the north and sea is at the south, having both plains and plateaus covering the remaining region.

Kandahar is one of the most significant region of Afghanistan. Kandahar was a gateway to India from Persia and for the safety of India and Kabul the Mughals were struggling to have strong control over the area. It connects South Asian subcontinent with Central Asia, Middle East and the Persian Gulf.

Badakhshan is a historical region comprising parts of what is now north-eastern Afghanistan, ... Its significance is its geo-economic role in trades of silk and ancient. Badakhshan has been an important area of economic participation and trade in goods and precious stones.

Learn more about geography here: https://brainly.com/question/12790602

Learn more: https://brainly.com/question/26043842

4 IN WHICH SECTION OF THE DECLARATION
OF INDEPENDENCE WOULD YOU FIND THIS
QUOTE?
"That these united Colonies are, and of Right
ought to be Free and Independent States, that
they are Absolved from all Allegiance to the
British Crown, and that all political connection
between them and the State of Great Britain, is
and ought to be totally dissolved; and that as
Free and Independent States."
A. Preamble
B. Grievences
C. Declaration
D. Manifesto

Answers

Answer:

Declaration

Explanation:

Because this is the section where they are declaring themselves separated from Britain.

Help help history please please please

Answers

Answer:

B directly from Vietnam

Question 1

What was one reason for the Siege of Savannah during the American Revolution?

A

to end the colonial boycott of British products

B

to end the British military occupation of the city

to force Savannah Loyalists to support the independence movement

D

to force Savannah businesses to provide military support to the Patriots

Answers

Answer:

A: The Southern Strategy was a British plan to win the Revolutionary War by concentrating their forces in the southern states of Georgia, South Carolina, North Carolina, and Virginia--where they believed the concentration of loyalists would be an advantage.

Explanation:

No explanation.....

One reason for the Siege of Savannah during the American Revolution was to end the colonial boycott of British products. The correct option is A.

What was the most important result of the siege of Savannah?

The French suffered a humiliating defeat as a result of the siege of Savannah, and British policy toward Southern Americans who were insurrection hardened as a result. Georgia Loyalists and their British protectors also came to the conclusion that upcountry resistance needed to be put down without mercy.

The British concentrated on protecting American colonies in the south due to the standstill in their conflict with the Americans in the north and worries of French raids against British-held Caribbean islands. Capturing Savannah, Georgia's port, was one of the main goals.

Thus, the ideal selection is option A.

Learn more about the Siege of Savannah here:

https://brainly.com/question/9315696

#SPJ5

Which way did great Britain leaders try to recover from the great depression

Answers

Answer: by lowering interest rates to help business

Explanation:

Hope this helps!

Answer:

by lowering interest rates to help business

Explanation:

C- by lowering interest rates to help business

Got 100% on edge quiz 2023.

I hope this is the answer you are looking for

What kind of law would be important enough for you to protest it?

Answers

Your amedments....................

Right to Protest ensures that people can act as watchdogs and constantly monitor governments' acts. It provides feedback to the governments about their policies and through consultation, after which the concerned government, meetings and discussion, recognizes and rectifies its mistakes.

what did George Washington do that inspired recruits to join the continental army


I gave you Brainlist ​

Answers

Answer:

Hoping to inspire soldiers and save his own job, Washington ordered all his officers to read Thomas Paine's "The American Crisis" to their troops. Paine, the passionate pamphleteer, was embedded with Washington's troops and had just written a now-famous essay on the back of a drumhead.

Explanation:

ta-daaa!!!!!

Answer:

Washington ordered all his officers to read Thomas Paine's "The American Crisis" to their troops.

Explanation:

hopefully this helped!

What are benefits of the two-party system for the United States? What are the negatives of a two-party system in the United States

Answers

Answer:

Advantages. Some historians have suggested that two-party systems promote centrism and encourage political parties to find common positions which appeal to wide swaths of the electorate. It can lead to political stability which leads, in turn, to economic growth.

Explanation:

How Did France Get its Captal

Answers

Answer:

because they not playing periodttt Nah I'm just playing but fr

By 52 B.C., Julius Caesar and the Romans had taken over the area, which eventually became Christianized and known as Lutetia, Latin for “midwater dwelling.” The settlement later spread to both the left and right banks of the Seine and the name Lutetia was replaced with “Paris.” In 987 A.D., Paris became the capital of ...

Explanation:

How do the government and news organizations keep track of
how the public feels about the issues and candidates?

Answers

In recent time, the government and news organizations keep track of public feeling towards certain issues and candidates through use of social media.

Before improved civilization, the government know people's feeling through issues by physical contact with them through regular local meetings.

The act of meeting with the citizen physically have changed because of variety of reasons.

In conclusion, today, the government and news organizations keep track of public feeling towards certain issues and candidates through use of social media.

Read more about social media

brainly.com/question/1163631

During what period did Harding,
Coolidge, and Hoover serve as
president?
A. Progressive Era
B. The Roaring 20's
C. World War I
D. World War II

Answers

Answer:

C) World War I

. . . . . . . . . . . . . . .

B The Roarin’ 20’s (All three of the Presidents served during the 1920’s, aka the Roaring 20’s)

What led to the decline of the Second Ku Klux Klan? Select the two correct answers.

A.)the Indian Citizenship Act of 1924

B.) increasing urbanization

C.) public scandals

D.) legislation from opposition groups

E.) the Scopes Trial verdict

Answers

Answer:

C and D

Explanation:

when did the peoples, who would become known as native americans, arrive in north america?

Answers

For decades archaeologists thought the first Americans were the Clovis people, who were said to have reached the New World some 13,000 years ago from northern Asia.
But fresh archaeological finds have established that humans reached the Americas thousands of years before that.
These discoveries, along with insights from genetics and geology, have prompted reconsideration of where these pioneers came from, when they arrived and what route they took into the New World.

9. History tells us about the literature, religion, art and architecture of a

Answers

Answer:

culture, era, period, time

Explanation:

any answers will work

What did the bloody massacre reveal

Answers

Bloody Massacre was designed to elevate a tragic incident into a politically motivated calamity and agitate the colonists' negative view of the British occupation of Boston.

Answer:

As a piece of propaganda, The massacre was designed to elevate a tragic incident into politically motivated calamity and agitated the colonost' negative view of the British occupation of Boston

Which major cities share a time zone?
A) London and Honolulu
B) Washington and Dallas
C) Washington DC and Boston
C
D) New York and Fort Worth
Which is it

Answers

Answer:

C

Explanation:

Select the correct answer.
What was an economic cause of the French Revolution?
© A.
a lack of representation of the third estate in the Estates-General
O B. increased influence of French thinkers such as Rousseau and Locke
C. the government's decision to raise taxes to pay its huge debts
D. the rise of Napoleon and his rallying of the citizens against the monarch


ANSWER: is C

Answers

Answer:

C

Explanation:

Identify China and Japan on the map by placing the letter that corresponds on the map to the Countries below.
China Japan

Answers

Answer:

A: Indonesia

B:Cambodia

C:Japan

D:South Korea

Indonesia ,Cambodia ,Japan, South, Korea

plsss help me

21 Answer:
Which of the following best describes the attitude of whites in the
South toward slavery?
a. Almost all were against slavery.
b. Only plantation owners paid any attention to the slave issue.
c. Slaveowners favored slavery, but most who did not own slaves
were against it.
d. Slaveowners and most who did not own slaves favored slavery.
22 Answer:
The book UNCLE TOM'S CABIN was one of the most important novels
published in the United States in the 1800's because it
a. was written by a slaveowner about slaves.
b. was written by a slave about slaves.
c. was the first successful novel published in the South.
d. was an influence on the feelings of people in the United States.
23 Answer:
The member of Congress who suggested the plan for the Compromise of
1850 was
a. John C. Calhoun
b. Henry Clay
c. Stephen Douglas
d. Frederick Douglas
24 Answer:
The Compromise of 1850 included all of the following except
a. California's admission as a free state.
b. the end of slavery in the District of Columbia.
c. the formation of New Mexico and Arizona from land claimed by
California.
d. the Fugitive Slave Act.
25 Answer:
The Missouri Compromise was partially repealed by the
a. Compromise of 1850
b. Kansas-Nebraska Act
c. Wilmot Proviso
d. Fugitive Slave Act

Answers

21) answer is D
22) I think that the answer is D as well but don't quote me
23) Anwser is B
24) Anwser is C
25) Anwser is B

state four problems facing Nairobi​

Answers

A lot of issues can be associated with different countries. The four problems facing Nairobi​ are;

Lack of good social services such as schools and hospitals.Lack of good or clean water.High crime rate as a result of unemployment.The rise in HIV and AIDS cases.

What are the problems that are found in Nairobi?

Nairobi is a place that is known to have some issues such as the lack of of stop signs and traffic lights at intersections, they also have poor road quality, and other issues.

There is no country that does not have issue but it is very important to handle theses issues so that the country can grow and develop more.

Learn more about Nairobi from

https://brainly.com/question/3390534

Why is it important for Ulysses to keep his disguise in the scene where he is reunited with his father? Why does he feel the need to test his father’s loyalty in this way?

Answers

Answer:

He wants to ensure that even his own family will be by his side regardless. He had nothing to do at that point but to see if his father also really knows him. Trust is also important in the family as much as it is important when meeting strangers and acquaintances

Explanation:

In his 20 years away from his home, Ulysses struggles through the Trojan War and a difficult journey home. He overcomes all the obstacles put in his path through his own wits and with the help of the gods. His lengthy struggle and the many betrayals seem to have affected him psychologically. He learns that he cannot trust people. He even approaches his son and wife while in disguise.

His father remains a suspect for disloyalty until Ulysses tests him. He tells Laertes a story about how his alter ego once gave shelter to Ulysses. He sees Laertes choke up and cry on hearing about his son, which proves his loyalty.

Other Questions
7,528 irrational or rational Which sentence below correctly uses italics?A. Is he your teacher?B. Is he your teacher?C. Is he your teacher? f(x) = -x^3+8x^2-15xDomain:Range: RRel. Maximum: X=3Rel. Minimum(s): X2End Behavior:As x, f(x)As x, f(x)Incr. Intervals:ZerosDecr. Intervals solve 4x-13=7x14 justify each step Cual es el pas de nacimiento Shakespeare Please help me answer this! ANSWER IN SCENTENCE FORMAT!!! :Two factors that affect climate patterns on Earth are the tilt of Earth on its axis and the topography of Earth. Describe how these two factors affect the climate patterns of Earth. Please help due tomorrow Giving Brainlesst What happened In world war SOLVE HYPOTENUSE LEG-HL-GEOMETRY What is the main idea of Hayess statement?A. He will let the South govern as it wishes.B. He will only look out for Northern interests.C. He will work to unite the interests of North and South.D. He thinks that the division between North and South is important.I think the Answer is "C". 1 2 3 4 5 6 7 8 9 10TIME REMAINING55:47A bill can be either __________, meaning that its contents and the discussion surrounding it are open to anyone, or __________, meaning that most discussions about the bill take place behind closed doors and are not widely known.A.censored . . . openB.hidden . . . privateC.public . . . privateD.public . . . exposedPlease select the best answer from the choices providedABCDMark this and return (If you don't know, don't answer)How can I solve them?1. 44=t722. 18+z=403.18(f)=914. 57=y25. 14=d+(10) In the convention of 1818 what did the U.S obtain from this treaty ?? AC current is produced by which of the following things? A. Remotes B. Generators C. Lights D. Lasers What is the area of a room that is 3 3/4 yards long by 3 1/3 yards wide? In which situation would a photographer most likely use butterfly, or paramount, lighting?landscape photographywildlife photographyaction photographyfashion photography 1 less then the quotent of a number n and 6 Draw the Lewis structures forCalcium bromide, CaBr2 What did farmers want the government to regulate in the late 1800's?1. Steel mills2. Unions3. Railroads4. Banks AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA