When glucose is totally oxidized to CO2 and H2O, how many ATP molecules are made by oxidative phosphorylation out of a maximum yield of how many ATP molecules?

Answers

Answer 1

Answer: 26 out of 30.

Explanation:

Out of 30 ATP molecules, 26 are produced from maximum oxidative phosphorylation production. Two more come from glycolysis and two more are from the citric acid cycle.

To power other cellular processes, ATP captures and releases chemical energy obtained from the breakdown of food molecules.


Related Questions

Is the trend in reactivity for nonmetals the same as the trend in reactivity for metals?

Answers

In Non-metals
Period - reactivity increases as you go from the left to the right. Group - reactivity decreases as you go down the group. hope this helps, sorry if it doesn’t

Answer:

no

Explanation:

In Non-metals

Period - reactivity increases as you go from the left to the right. Group - reactivity decreases as you go down the group

In Metals

Reactivity increases down a group because as nuclear shielding increases and the nucleus' hold on the valence electron weakens, therefore it is easier to remove valence electrons.

What are the flocculation basins?

Answers

Answer:

Flocculation is the operation in which the coagulated water must be gently mixed at a propeller speed of 15 to 20 rpm to promote the growth of the floc. ... The flocculation basin often has a number of compartments with decreasing mixing speeds as the water advances through the basin.

Can someone help please

Answers

Answer:

d. cells are made of atoms and molecules. :)

Explanation:

hope i helped

4th. Cells are made of atoms and molecules

How does Global warning affect the ocean

Answers

Answer:

The ocean absorbs most of the excess heat

Explanation:

Increasing ocean temperatures affect marine species and ecosystems. Rising temperatures cause coral bleaching and the loss of breeding grounds for marine fishes and mammals.

Subject: Chemistry


whoever does this right will give the brainliest <3)

Answers

Answer:

1 A

3 main types of bond are

Ionic bond ( formed due to complete transfer of electron between atoms(

Covalent bond ( formed by mutual sharing of electron)

Metalic bond ( present in the metals due to mobile electrons)

1 B bond in CaO is ionic bond formation in attached image

1 C hydrogen bond with nitrogen is covelent NH3 ammonia is formed because a bond between two non metals is expected to be covalent

More their electronegativity difference between hydrogen and nitrogen is less than 1.7 that makes it covalent

Explanation:

Answer: This looks tough

Explanation:


1. How much heat is required to heat 22 grams of Aluminum from 15 °C to 49° C

Answers

Answer:

670.956

Explanation:

You can use this equation to solve for heat :

Q = m * c * ΔT

Q represents the heat

m represents the mass in kilograms

c is the specific heat. For aluminum, it's 897

ΔT is the change in temperature, so, 49 - 15 which is 34

Plug in the numbers and you get this :

Q = 0.022 * 897 * 34

Q = 670.956 Joules

12.3 moles of sodium is what mass of Na?​

Answers

Answer:

1 mole of Na = mass of 22.99 g, 1 mole of Si = mass of 28.09 g.

Can someone tell me the answer plz plz I’ll give you brainlist and points plz This is my final test No wrong answers

Answers

Answer:

Energy can enter or exit an open system

Explanation:

D

manganese atom has 30 neutrons and atomic number 25
determine the electron cloud charge of manganese​​​

Answers

Answer:

the most common oxidation no.of manganese is + 2 + 3 + 4 + 6 + 7

Explain why the temperature of distilled water is kept at 37°C ?

Answers

At 37°C, the pH of distilled water is actually around 6.8, which means the human extracellular fluid is quite alkaline. However, the intracellular pH of the warm-blooded human is still around 6.8. This has been confirmed by various destructive and non-destructive measurements.
(I’m sorry if I responded too late! I hope it helps)

Answer:

the temperature of distilled water is kept at 37 because it needs to kill off some microbes.

Compare the atomic radii of neutral atoms 7N,8O,11Na and 12Mg and expalin briefly

Answers

Okay that’s cooo and yeah basinsnsjeidnsjw12539484!( is the correct answer

help with this asap please

Answers

ΔH rxn = 434.7 kJ

Further explanation

Given

C+O₂⇒CO₂   ΔH=-393.5 (reaction 1)

2CO+O₂⇒2CO₂  ΔH=-566 (reaction 2)

2H₂O⇒2H₂+O₂ ΔH=483.6 (reaction 3)

Required

ΔH rxn

Solution

Reaction 1 : no change

C+O₂⇒CO₂   ΔH=-393.5

Reaction 2 : the reaction is reversed and divided by 2

CO₂⇒ CO+1/2O₂ ΔH=-283

Reaction 3 : divided by 2

H₂O⇒H₂+1/2O₂ ΔH=241.8

-------------------------------------------

C+H₂O⇒CO + H₂ ΔH rxn= -434.7 kJ

A ball is moving at a speed of 6.70 m/s. If the kinetic energy of the ball is 3.10 J, what is the mass of the ball?​

Answers

Answer:

0.14 kg

Explanation:

The mass of the ball can be found by using the formula

[tex]m = \frac{2k}{ {v}^{2} } \\ [/tex]

v is the velocity

k is the kinetic energy

From the question we have

[tex]m = \frac{2(3.10)}{ {6.70}^{2} } = \frac{6.20}{44.89} \\ = 0.138115...[/tex]

We have the final answer as

0.14 kg

Hope this helps you

Which science process skill uses numbers to describe objects​

Answers

Answer: Science process skills include observing qualities, measuring quantities, sorting/classifying, inferring, predicting, experimenting, and communicating.

Releases energy in the form of ATP
Stores energy in glucose molecules.
Perfomed by producers
Perfomed by consumers.

Answers

Explanation:

Both (Photosynthesis and Cellular respiration)

Because

In Cellular respiration energy is released in the form of ATP and In plants glucose stored in the form of energy. Plants are producers. Animals are consumers.

Therefore,

Both is correct✔

how is the strength of an acid affected by the number of hydrogen ions it contains​

Answers

Answer:

The greater the number of hydrogen ions, the increase in the acid strength.

Explanation:

Hydrogen ions determine the pH of the acid, greatest number of hydrogen ions give the pH value below 4 hence strong acid, and least number of hydrogen ions give a pH value above 4 but less than 7 hence a weak acid

Is science logical please help meeeeeee

Answers

Answer:

It kind of is logical so my answer is yes

Yes science is logical

what is a caterpillar

Answers

Answer:

ca ater pillar

Explanation:

there cute little fuzzy guys and they're amazing and beautiful

An object is placed at 0 on a number line. It moves 3 units to the right, then 4 units to the left, and then 6 units to
the right. What is the displacement of the object?
1
5
7
13

Answers

your answer is five ;))))

Answer:

the answer will be five

Explanation:

i got this question on a test and i got it right

Methane(CH4) is a gas at room temperature, Methanol (CH3OH) is a liquid. Explain why using types of intermolecular forces present.

Answers

Explanation:

Methane is a gas at room temperature but methanol is a liquid because in methane there's London dispersion intermolecular force but in methanol there's H-bond and London dispersion force. H-bond is more stronger than London dispersion force. So, it increases the boiling point of methanol that's why methane is gas at room temperature due to weak attraction of London dispersion force and methanol is liquid.

Methanol has a higher boiling point than methane due to stronger intermolecular forces (IMFs), or attraction between individual molecules. This makes its molecules more difficult to separate, requiring more energy and resulting in a higher boiling point.

What are intermolecular forces?

An intermolecular force is a force that mediates the interaction of molecules, including electromagnetic forces of attraction or repulsion that act between atoms and other types of neighboring particles, such as atoms or ions.

Intermolecular forces are classified into five types namely,

Ion-dipole forces.Ion-induced dipole forces.Dipole-dipole forces.Dipole-induced dipole forces.Induced dipole forces.

Between ions and polar dipole molecules, ion-dipole forces exist.

Since of stronger intermolecular forces (IMFs), or attraction between individual molecules, methanol has a higher boiling point than methane.

This makes it more difficult to separate its molecules, requiring more energy and resulting in a higher boiling point.

Thus, this is the reason of using types of intermolecular forces present.

For more details regarding intermolecular forces, visit:

https://brainly.com/question/9007693

#SPJ2

3. (10 Points) Write a double replacement reaction where one of the products is
copper (11) oxide. Include the states of matter for each of the reactants and
products.

Answers

Answer:

Up to now, we have presented chemical reactions as a topic, but we have not ... A single-replacement reaction is a chemical reaction in which one element is ... single-replacement reactions will occur between two given reactants. This is ... Use the activity series to predict the products, if any, of each equation.

Explanation:

SOMEONE ANSWER?!!?!?!,!,EMERGENCY Can someone tell me the answer plz plz I’ll give you brainlist and points plz This is my final test No wrong answers

Answers

Answer: Should be A)

Explanation:

the size of planets effects the amount of gravitational force each planet has, like jupiter, it has the most gravity.

An 80 gram sample of a radioisotopes decayed to 40 grams in 3 days how many grams of the original sample would remain after 9 days

Answers

Answer: 10 grams

Explanation: Original sample is 80 gram and every three days half of its composition decays so 80 down to 40 in the first 3 days, 20 in the next three days, and  10 in the last three days

Which two options
are
examples of chemical changes?

Answers

Where are the options?




But some examples of chemical changes are:
Burning
Change in color
Change in temperature
Noticeable odor

PLEASE HELP!!!! A solution contains 35 grams of sugar per liter of solution. How many grams of sugar are in 2.5 L?

Answers

87.5 I believe because it needs 2.5 L and we multiply 35 by 2.5 because 1 liter needs 35 grams

What is the name of each labeled part?



Answers

Answer:

A - dendrites

B - cell body

C - axon terminal

D - myelin sheath

E - nucleus

Hope that helps.

A-dendrite

B-cell body

C-axon terminal

D-axon

E-nucleus

Please if you don't know don't answer​

Answers

Answer:

Mass = 50kg, a = 20m/sec^2

F = MA

F = 50 * 20

F = 1000N

F = MA

650 = M * 10

M = 650/10 = 65kg

The phenomenon of weightlessness occurs when there is no force of support on your body. when your body is effectively in free fall, accelerating downward at the acceleration of gravity, then you are not being supported.

F = Gm1m2/distance^2

F = 6.6726* 10 ^-11 * 70 * 5.98 * 10^24/(6.38 * 10^6)^2

hope it helps you

During a chemical or physical change, energy may be...

a. created into another form
b. destroyed and reinvented into another form
c. converted into another form
d. disappeared​

Answers

Answer: C: Converted into another form

Explanation: pues es esa calale y si va a hacer

During a chemical or physical change, energy is converted to another form. Energy cannot be created or destroyed. During a chemical reaction, physical change the energy and mass are conserved.

What is law of conservation of energy ?

According to the law of conservation of energy energy can neither be crated nor be destroyed. Hence, the total energy of a system is always conserved.

However, energy can be transformed from one form to the other. Therefore, the energy lost in one form is gained in another form. For example, in all electrical devices, the electrical energy is converting to other forms of energy such as light, thermal , mechanical etc.

Similarly, during a chemical reaction, the energy released by a reaction system is equal to the energy absorbed by other reacting system. Similarly in electrochemical cells the chemical energy is converting to electrical energy.

Find more on energy transformation:

https://brainly.com/question/17589256

#SPJ6

Which waves carries the most energy?


HURRY PLZZ!!!!

I NEED HELP FAST!!!

GOD BLESS!!!

THE SUBJECT IS SCIENCE I CAN´T FIND IT!!!!!!!!!!!

Answers

Answer: D Because it is moving at a fast pace

Explanation:

The higher the amplitude the more energy a wave has. So A should be your answer

Do you think it would be a good idea for a bumper car ride to have minimum and maximum weight requirements for riders? Apply Newton's second and third laws of motion in your response.

Answers

Answer: If only max or min yes but if we have min and max that is a bad idea it is not as safe.

Other Questions
solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons. one of u guys helped me but they keep returning it saying show your work>:( how do you find the area of a triagnle and a rhombus in gerneral Present at least one paragraph describing your experience will the illusions lab. What are your thoughts about the experience? Which illusion was your favorite? Lisa is in the eighth grade. Normally she is active in clubs, plays sports, and gets good grades, but lately she hasn't been feeling well. Her throat issore and her lymph nodes feel swollen. She is running a fever and feels exhausted all of the time.Lisa's doctor diagnoses her withand tells her that although she can treat the fever, she cannot prescribe antibioticsbecause Lisa's disease is viral. She recommends that Lisa forego sports and cut way back on her activities. She may not be able to go to schoolfor several weeks.What did the doctor diagnose her with??? Hamburger buns come in packages of 12. Hamburger patties come in packages of 8. Bob would like to buy the smallest number of hamburger buns and hamburger patties so that he will exactly one hamburger patty per bun. How many packages of hamburger buns and hamburger patties must he buy?PLEASE ANSWER QUICK I WILL GIVE LOTS OF POINTS What is the value of the expression expression 9 m. If m = 3, n = 8, and p = 1?