Answer:
Explanation:
There are clear differences in territorial borders. The United States gained not only the land in its expansion but the authority that goes with it. More especially they have greater access to wealth and resources giving them an edge in purchasing and owning more and more lands and territories.
A leech attaches to an animal and feeds off the animal's blood.
What happens to the animal the leech attaches to in this scenario?
It loses nutrients to the leech.
It gains nutrients from the leech.
It will be killed and eaten by the leech.
It will kill and eat the leech.
Answer:
Explanation:
A
Answer: [A] It loses nutrients to the leech.
Explanation:
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
Answer:
look at explanation
Explanation:
basically in order to go from mrna to trna just replace
a becomes u
g becomes c
u becomes a
c becomes g
what is colustrum? explain plz
Why is the metric system more scientific than the English system?
A. The English system is older than the metric system, and so it is less relevant.
B. The English system is only used in English-speaking countries.
C. The English system was based on human traits, while the metric system was founded on physical constants.
D. The English system must be converted to the metric system using conversion factors.
Answer:
Unlike the British Imperial System, the metric system, or SI (from the French Système International), is based on a natural constant.
Explanation:
The metric system is more scientific than the English system because the English system was based on human traits, while the metric system was founded on physical constants.
What do you mean by the Metric system?The metric system may be defined as the scientific way of measuring weights, and distance in kilograms and meters respectively with the help of a decimal system.
The metric system may also be known as the SI system. SI system is not based on the human traits rather then it depends on the natural constant. It is more precise, standard, and easy to understand.
Therefore, the correct option for this question is C.
To learn more about the Metric system, refer to the link:
https://brainly.com/question/1576704
#SPJ2
the role of dna in cellular differentaation
Answer:
controls the way cells function, also determines what type of specialized cells will be made.
How could plate tectonic movements affect the evolution of life?
Answer:
A planet with oceans, continents, and plate tectonics maximizes opportunities for speciation and natural selection, whereas a similar planet without plate tectonics provides fewer such opportunities. Plate tectonics exerts environmental pressures that drive evolution without being capable of extinguishing all life. Explanation: trust :0
Fill in the blanks below with the correct word to complete the sentence.
Water is warmed by the sun and
It is then cooled and
Finally, it is brought back to Earth in the form of
Answer:
Evaporates, Condensed, Liquid Water
Explanation:
Water is warmed by the sun and evaporates
It is then cooled and condensed
Finally, it is brought back to Earth in the form of Liquid Water
Answer:
Fill in the blanks below with the correct word to complete the sentence.
Water is warmed by the sun and evaporate
.
It is then cooled and condensation
.
Finally, it is brought back to Earth in the form of
Water
⇒ precipitation.
Explanation:
got it right 9/23/22
Which is an example of a statement about climate?
OPTIONS
It rained 3 inches last night.
Snow and very low temperatures are predicted for tomorrow.
Florida is known for its sunny skies and warm temperatures.
I plan to go swimming tomorrow.
Answer: Florida is known for its sunny skies and warm temperatures.
Explanation: Climate refers to long term weather. This statement indicates that Florida has a usual weather. Usual can be otherwise known as long-term.
Double stranded RNA is cleaved by
Answer:
Dicer
RNA-dependent RNA polymerase amplifies siRNAs by binding to them and making more dsRNA, which is recognized and cleaved by Dicer into secondary siRNAs. The result is the silencing of genes by amplifying the RNAi effect. In certain cases RNAi also silences genes by the formation of heterochromatin.
thrips are insects that feed on rose
Answer:
????????????????????????
What is Not a correct statement about chromosomes,Dna,or genes
Image below
A dowry is:
A.
Money or property given by a man to or for his bride
B.
A gift given by the bride to her mother-in-law
C.
Money or property given by a man to his parents
D.
Money or property given by the bride to her parents
Answer:
B
Explanation:
As dowry system is the social problem in which the bride/bride's family has to give money or property to the groom's family.
The bride/bride's family has to give money or property to the groom/groom's family on their marriage.
In which part of the male reproductive part do pollens found? A. Anther B. Filament C. Stigma D. Style
Answer:
Anther
Explanation:
Stamen is a male reproductive part in which anther produce male reproductive cells.
Answer:
The stamen is made up of two parts: the anther and filament. The anther produces pollen (male reproductive cells). The filament holds the anther up. During the process of fertilization, pollen lands on the stigma, a tube grows down the style and enters the ovary.
Explanation:
Which statement best describes energy release in cellular respiration? (1 point)
Stored chemical energy is broken down and released in the cytoplasm.
Stored chemical energy is broken down and released in the cytoplasm.
Stored chemical energy is broken down and released in the mitochondria.
Stored chemical energy is broken down and released in the mitochondria.
Stored chemical energy can be used immediately and is released in the cytoplasm.
Stored chemical energy can be used immediately and is released in the cytoplasm.
Stored chemical energy can be used immediately and is released in the mitochondria.
Answer:
During cellular respiration, glucose is broken down in the presence of oxygen to produce carbon dioxide and water. The energy released during the reaction is captured by the energy-carrying molecule ATP (adenosine triphosphate).
So the answer is Stored chemical energy is broken down and released in the mitochondria.
Explanation:
In cellular respiration, stored chemical energy is broken down and released in the mitochondria. The correct option is B.
What is mitochondria?Mitochondria are the membrane-bound organelles that create the maximum of the chemical energy necessary to power the biochemical reactions of the cell.
The mitochondrial energy is stored in a small molecule referred to as adenosine triphosphate (ATP).
Cellular respiration is the way by which organic fuels are oxidized in the presence of an inorganic electron acceptor, encompassing one as oxygen, to give enormous amounts of energy and pressure the majority production of ATP.
Cellular breathing is the way by which cells in plants as well as animals break down glucose and convert it into power, which is then used to perform work.
The goal of cellular respiration is simple: to provide the energy that cells require to function.
Thus, the correct option is B.
For more details regarding cellular respiration, visit:
https://brainly.com/question/13721588
#SPJ5
Which of these forms when air moves in the directions shown by the arrows
in the diagram?
A ) Valley Breeze
B) Land Breeze
C ) Mountain Breeze
D ) Sea Breeze
Answer:
C.
Explanation:
Please do brainless :)
Mountain breeze refers to the fact that the surface breezes are coming from the mountain and blowing into the lowlands. Thus, option C is correct.
What is the movement of air in mountain breeze?The air cools during the night and flows into the valley from the mountainside.
As a result, the breeze blows in the other direction; it travels from the mountains to the plains and valley floor. This wind is therefore referred to as the mountain breeze.
As the air rushes in to fill the space, the air pressure decreases and a gust of wind is produced. A valley breeze, on the other hand, develops when cooler air in the valley falls to fill the space left by the warm air rising.
Therefore, Mountain Breeze in which air move from high pressure to low pressure.
Learn more about mountain breeze here:
https://brainly.com/question/12997458
#SPJ5
The population of mice in a local forest ecosystem has recently died out due to disease. In the past, these mice made up a large part of the diet of the forest fox.
What is the best prediction about what will happen to the foxes?
Consider the fact that cancer is most easily defeated when it is found early, and then consider the time and expense involved in diagnosing a potential case of cancer.
Answer:
Early diagnosis of cancer focuses on detecting symptomatic patients as early as possible so they have the best chance for successful treatment. When cancer care is delayed or inaccessible there is a lower chance of survival, greater problems associated with treatment and higher costs of care.
Explanation:
what is science explain
Science refers to the construction of knowledge by using the scientific method. This method is based on empirical evidence.
Science can be defined as the construction of knowledge (scientific knowledge) by using the scientific method.
The scientific method includes several sequential steps:
ObservationAsk questionsForm a testable explanation (hypothesis)Test the hypothesisCollect results (empirical evidence)Draw conclusionsIn the scientific method, empirical evidence can be used to support the working hypothesis.
Learn more about the scientific method here:
https://brainly.com/question/7508826
science, any system of knowledge that is concerned with the physical world and its phenomena and that entails unbiased observations and systematic experimentation. In general, a science involves a pursuit of knowledge covering general truths or the operations of fundamental laws.
NO NEED TO THANKS ME IT'S MY PLEASURE TO HELP U DEAR( ꈍᴗꈍ)
Giving Away 50 points + brainy to first
Ava has been reading about the interactions among the components of the Earth. This group of components work together to make a/an ____
The group of components of the Earth work together to make an environment we live in.
What are the different components of the Earth?The interactions between Earth's five systems—the geosphere, biosphere, cryosphere, hydrosphere, and atmosphere—create the environment we are accustomed to.
The Earth's interior and surface, which are both formed of rocks, make up the first system, the geosphere. The second system is made up of the little area of the planet that may sustain life; this area is known as the biosphere. The third system contains the hydrosphere, or regions of Earth that are completely covered with water. The fourth system is the atmosphere, a gaseous envelope that maintains the planet's temperature while also supplying carbon dioxide for photosynthesis and oxygen for breathing. The cryosphere, which is composed of enormous amounts of ice in the poles and elsewhere, is the fifth system. The maintenance of the Earth as we know it depends on the interaction of all five of these vast and intricate systems.
Learn more about Earth's component, here:
https://brainly.com/question/11250595
#SPJ5
According to Hebrews 11, what did Abraham believe God would do if Isaac was slain as a sacrifice?
Abraham believed that God could raise Isaac from the dead or more specifically that he could raise the Dead
You are working with a population of snails. During the mating season, you observe that individuals in the population will only mate with others of the same genotype. For example, Mm individuals will only mate with Mm individuals, and mm individuals will only mate with other mm individuals. There are only two alleles for this gene (M is dominant; m is recessive). You have determined that the frequency of the M allele is 0.5. After one generation, what is the expected genotype frequency for Mm individuals in this population
If matings are not random in a population and individuals mate with other individuals of similar genotype/phenotype, h0m0zyg0us frequencies increase. In this example, the genotype frequency for Mm is F(Mm) = 0.25.
---------------------------------
In the exposed example, one of the assumptions of Hardy-Weinberg equilibrium is not accomplished. There are non random matings.
Individuals mate with other snails of the same genotypes
MM x MM
Mm x Mm
mm x mm
We can assume this is an example of matings by similar phenotypes.
Eventually, this mating system leads to an increase in the h0m0zyg0us genotype frequency, at the expense of heter0zyg0us ones in loci that determine the trait.
Allelic frequencies do not change. Only genotypic frequencies do.
This mating system tends to separate the population into two subgroups, decreasing the amount of heter0zyg0us individuals.
Matings Progeny
MM x MM 4/4 MMMM x Mm 1/4 MM + 2/4 Mm + 1/4 mmmm x mm 4/4 mmZygotic population of the next generation
F(MM) = 4/4 MM + 1/4 MmF(Mm) = 1/2 MmF(mm) = 4/4 mm + 1/4 MmSo, in the exposed example we know that the frequency of the dominant allele M is 0.5
f(M) = p = 0.5
knowing that p + q = 1, we can clear the equation to get the frequency of the recessive allele.
p + q = 1
0.5 + q = 1
q = 1 - 0.5
q = 0.5
f(m) = q = 0.5
Zygotic population of the next generation
F(MM) = 4/4 MM + 1/4 MmF(MM) = p² + 1/4 (2pq)
F (MM) = 0.5² + 1/4 (2 x 0.5 x 0.5) = 0.25 + 0.125
F(MM) = 0.375
F(Mm) = 1/2 MmF(Mm) = 1/2 (2pq)
F(Mm) = 1/2 (0.5)
F (Mm) = 0.25
F(mm) = 4/4 mm + 1/4 MmF(mm) = q² + 1/4 (2pq)
F(mm) = 0.5² + 1/4 (2 x 0.5 x 0.5) = 0.25 + 0.125
F(mm) = 0.375
The expected genotype frequency for Mm individuals in this population is F(Mm) = 0.25.
------------------------------
You can learn more about mating systems at
https://brainly.com/question/13007693?referrer=searchResults
https://brainly.com/question/19186330?referrer=searchResults
https://brainly.com/question/15737843?referrer=searchResults
need help with the top question :p
what is the effect of atmospheric disturbances on stars
This the correct answer
Explanation:
However,when light enters the Earth's atmosphere,the different wind speeds distort the light waves,leading to distortions in the image of stars.The effects of the atmosphere can be modeled as rotating cells of air moving trubulently.
#carryonlearning
#brainlyeveryday
#ctto
An antibody is a foreign substance in the body.
a. True
b. False
If a firm hires 10 workers at $9 per hour each and the 11th worker will be hired only if the wage rate falls to $8 per hour, the marginal wage rate must be _____.
Multiple Choice
−$2
$2
−$2.20
$2.20
Answer:
-2 USD
Explanation:
is the chemical reaction below A. Kinase B. mutase C. dehydrogenase D. isomerase E. none of the above
Answer:
I think it's either mutase or dehydrogenase, but I'm not exactly sure why. I haven't taken a chemistry class yet, so I don't know too much about it TBH.
b) Give an example of an animal with radial symmetry and an example of an animal with bilateral
symmetry. (2 points)
Answer:jellyfishes, corals, anemones, and ctenophora.
Explanation:
Examples of animals that possess bilateral symmetry are: flatworms, common worms ("ribbon worms"), clams, snails, octopuses, crustaceans, insects, spiders, brachiopods, sea stars, sea urchins, and vertebrates.
Isabel is researching the effects of deforestation using online sources. She finds an environmental study on the relationship between deforestation and local weather. Which of the following characteristics should this study have in order for its results to be considered valid?
I. Empirical observations
II. Evidence that can be replicated
III. Outcomes that don't change with new experimentation
A. I and II
B. II and III
C. I and III
D. I only
Answer:
Here is something that might help you
Explanation:
I am not trying to plagiarize, just trying to help.
Learn more of where I got this answer at https://brainly.com/question/24430205?referrer=searchResults. Trust me, it is not a site that will steal any of your information, phone numbers, or passwords. I hope I helped.
What is a long chain of one-ring sugar molecules?
Answer:
polysaccharide
Explanation:
Question 7(Multiple Choice Worth 2 points) (06.02 MC) Read the two sentences. The boy scored the winning goal is on my team. name is Greg. Select the words that complete the sentences. o . that. His that. Their O who. His who. Their
Answer:
The boy that scored the winning goal is on my team. His name is Greg.
Explanation: