Low pressure component of weather results in stormy, cloudy weather. Therefore, option (B) is correct.
What causes cloudy and stormy weather?Low pressure systems in the atmosphere are often to blame for the weather patterns of cloudy and stormy conditions. When there is low pressure in an area, it causes the air pressure to rise, which can result in the development of clouds and the production of precipitation. Low pressure systems have a tendency to produce air that is unstable, which can lead to severe weather such as thunderstorms, hurricanes, and other forms of severe weather.
In contrast, high pressure systems almost always result in weather that is free of clouds and precipitation. This is because the air that surrounds the high pressure area is sinking and remaining relatively still. The formation of gloomy and stormy weather can also be influenced by a variety of other factors, including temperature, humidity, and the direction and speed of the wind.
Learn more about cloudy weather, here:
https://brainly.com/question/1408324
#SPJ2
Which feature of the Earth's surface is caused by wind?
A)
rock quarries
B)
canyons
C)
sand dunes
for
D)
mountains
Answer:
b canyons
Explanation:
In ancient times, people believed Earth was the center of the Solar System. Which of the following makes the geocentric model impossible?
O The moon revolves around Earth.
O Earth's gravitational force is much less than the Sun's.
o Orbits are elliptical, not circular
There are other planets that are closer to the Sun.
Assume that one backbone of a DNA molecule has the sequence given below. A-T-G-G-G-G-G-C-G-A-T-A-T-T-T-T-A-T-C-C-G-A-C-G For this sequence: give the expected sequence of the other DNA backbone. T-A-C-C-C-C-C-G-C-T-A-T-A-A-A-A-T-A-G-G-C-T-G-C give the RNA sequence transcribed from the original DNA backbone. U-A-C-C-C-C-C-G-C-U-A-T-A-A-A-A-U-A-G-G-C-U-G-C give the Amino Acid sequence of the protein built from the original DNA backbone.
Answer:
DNA: ATGGGGGCGATATTTTATCCGACG
RNA: AUGGGGGCGAUAUUUUAUCCGACG
Protein: MGAIFYPT
Explanation:
Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.
What is AB?
A
12
B.
C
35
Answer:
hah? i don't get it
Explanation:
B. Suspension c. Solution
D. Saturated solution
5. Which is a solvent in a cup of coffee?
A. coffee
B. creamer
c. sugar
D. water
6. Why should you shake the liquid medicine before drinking?
A. To make it effective. C. To mix the suspended particles at the bottom.
B. To make it taste better. D. To make it clear.
7. What should be done in a liquid medicine before drinking it?
A. Drink right away after opening. C. Let it stand for 3 minutes
B. Shake well
D. All of these
8. Which of the following is called a universal solvent?
A. water 8. gasoline C. juice D. diesel
m-Directions: For items 1-5 What method are you going
Answer:
5.c 6.c 7.b 8.a
Explanation:
I hope it helps u :)
A scientist is observing a new species of organism. She observes that from generation to generation many of the organisms’ offspring have adaptations that their parents did not have. This organism is most likely reproducing through_______.
a. sexual reproduction
b. budding
c. asexual reproduction
d. binary fission
This equipment can be used for plowing ,planting,cultivating,mowing soil and pulling farm machinery,what is it?
Transcription is the process of making
Which hot and dry biome is home to large herds of herbivores that feed on many types of grasses?
Answer:
grasslands
Explanation:
Because it's most resistant to deterioration, which type of molecule is most often found in molecular fossils?
A. RNA molecules
B. Protein molecules
C. DNA molecules
D. Lipid molecules
Answer:
Of the four main groups of organic molecules, Lipids are the most resistant to decay. They are also highly insoluble in water. All cells produce this type of organic compound to be used in their membranes and in energy storage. These type of organic molecules are found in kerogens
describe how you would test a sample of powdered milk to see if it contained protein
Answer:
How would you contained protein
Explanation:
One would test a sample of powdered milk to see if it contained protein by using copper sulfate solution and sodium hydroxide solution.
What is protein?A structure composed of amino acids. The body need proteins to function properly. They serve as the building blocks for several bodily components, including the skin, hair, and enzymes, cytokines, and antibodies.
An essential component of a balanced diet is protein. Amino acids are the chemical "building blocks" that make up proteins.
Amino acids are used by your body to create hormones, enzymes, and to build and repair muscles and bones. They can be utilized as a source of energy as well.
The test can be done as:
To your meal solution, add a few drops of copper sulfate solution. A few drops of sodium hydroxide solution should be added. Protein is present in the food if the solution becomes purple.Thus, using copper sulfate solution and sodium hydroxide test, one can determine the protein content in the sample.
For more details regarding protein, visit:
https://brainly.com/question/29776206
#SPJ2
What practice helps scientists avoid bias in their findings
Determine the rate of oxygen consumption at each temperature for comparison. Then divide the higher rate by the lower rate to obtain the difference (ratio) between the two temperatures. Round your answer to the nearest 0.1. It can be concluded that mouse respiratory rate (increases or decreases) when temperature is lowered. In this experiment there was a fold difference in respiratory rate at the two temperatures.
Answer:
In mice rate of respiration increases as the temperature drops.
Explanation:
As the temperature decreases, the respiration rate also decrease because the body needs less oxygen for the production of energy. But in the case of mice, the rate of respiration decreases and the reason is the fear. Results showed that the respiration increased in mice as the decrease in temperature occur, caused due to the fear instilled in the mice towards cold temperature so in mice rate of respiration increases as the temperature drops.
Which is an adaptation that helps birds maintain a stable body temperature?
air sacs connected to lungs
large chest muscles
down feathers
nearly hollow bones
Answer:
the answer is down feathers. Or C
Explanation:
I just took the unit review test
in what parts of the cycle do you think phosphorus spends the most time
Answer:
what is a phosphorus
Explanation:
The mutations responsible for the dark fur color in the Arizona mice were absent from the three different populations of New Mexico mice. No Mc1r mutationswere associated with dark fur color in the New Mexico populations. These findings suggest that adaptive dark coloration has occurred at least twice in the rock pocket mouse and that these similar phenotypic changeshave different genetic bases. How does this study support the concept that natural selection is not random
Answer:
Following are the solution to the given question:
Explanation:
Please find the complete question in the attached file:
In the given question, the whole study reinforces the fact which natural selection also isn't transformed through producing much more confirmation which genetic polymorphisms occur because once required as well as that they can produce the very same mutation as a function of climate transformation except in specific environments.
These are carbohydrates -rich vegetables EXCEPT
a. Tubers
b. nuts
c. seeds
d.roots
Ethylene, a hormone found in plants, is produced to ripen fruits. These fruits ripen and drop to the ground where they release seeds. Which two plant systems are interacting when this occurs?
Answer:
Response and reproduction system
Explanation:
What evidence do we have that all continents were merged into one super-continent called Pangaea 250 million years ago?
Glacial deposits, specifically till, of the same age and structure are found on many separate continents that would have been together in the continent of Pangaea. Fossil evidence for Pangaea includes the presence of similar and identical species on continents that are now great distances apart.
The diagram below represents a sample of a sedimentary rock viewed under a
microscope. Which part was formed first?
Which of these genotypes represents a carrier?
Аа
aa
XXY
AA
Answer:
Aa
Explanation:
from what I can remember from 7th grade science
PLEASE HELP!!!!
Explain what causes a muscle to go into rigor mortis. Your answer should include the circumstances which cause it, as well as why those circumstances cause the effect (what is happening in the muscle at a molecular level which causes the stiffness).
Explanation:
Rigor mortis develops as the body's energy source (adenosine triphosphate [ATP]) is depleted. Muscle fibers require ATP for relaxation; once depleted, actin and myosin proteins remain complexed, resulting in stiffening of the muscles..
Thanks my answer and vote it 5 star and Mark it in brainliest answers please please please please please please please please please please please please please please please please please please please please please please
You perform an experiment in which chromatin is isolated from sea urchin sperm cells and briefly digested with micrococcal nuclease. When the chromatin proteins are removed and the resulting purified DNA is analyzed by gel electrophoresis, you observe a series of DNA fragments that are multiples of 260 base pairs in length (that is, 260 bp, 520 bp, 780 bp, and so forth). a) Although these results differ somewhat from the typical results discussed in the chapter, explain why they still point to the likely existence of nucleosomes in this cell type. b) What can you conclude about the amount of DNA that is associated with each nucleosome
Answer:
a) DNA fragments associated with histone proteins are all multiple in length (i.e., 260 bp, 520 bp, 780 bp, etc), thereby suggesting the presence of a pattern of organization in the chromatin
b) it suggests that each unit of organization (ie, each nucleosome) consists of 260 bp associated with chromatin proteins
Explanation:
The nucleosome is considered as the basic unit of chromatin. A nucleosome consists of approximately two turns of DNA wrapped around a core of eight histone proteins (i.e., a histone octamer). The histone octamer consists of two copies of each of the histones H2A, H2B, H3, and H4. Moreover, the nucleosomes are connected together by linker DNA sequences which vary between 10 and 100 bp in length.
Where do nutrients enter the body?
Answer:
thru the nucleus or cell wall i think
Explanation:
Answer: The small intestine absorbs most of the nutrients in your food.
Explanation: The small intestine is good for absorption due to it having a large inner surface area.
Which of the following is not a function of the bacterial cell wall?
A. Provide the cell with shape and rigidity
B. Prevent the cell from lysing
C. Protect the cell
D. Provide the cell with locomotion
Answer:
D
Explanation:
I believe locomotion would be the job of the flagellum
The correct option that is not a function of the bacterial cell wall is : ( D ) Provide the cell with locomotion
The Bacterial cell wall acts mainly as a protective cover to the cell of the bacterium, protecting the cell from lysing ( preventing the breakdown of the cell via osmotic pressure ). The cell wall also provides the cell with shape a and rigidity.
While The locomotion of the cell is not the responsibility of the cell wall but it is made possible by the flagellum.
Hence the non - function of a bacterial cell wall is providing the cell with locomotion.
Learn more : https://brainly.com/question/2139006
Based on scale of 100 and represents average performance
Answer:
Ok what is the question good sir/madam?
Answer:
Explanation:
Yes i agree with the other answer SIr or Ma'am but i don't know if this question!
Sexual harassment in the workplace is a crime when committed by anyone, regardless of position, role, or gender. Please select the best answer from the choices provided ОТ OF
Answer:
The answer is true.
In a professional environment, sexually degrading comments and actions are legally prohibited.
Given a DNA sequence of ACG, what would be the corresponding RNA sequence? Once you determine the RNA sequence, what would be the corresponding amino acid for the RNA codon? Would a change in one nucleotide of the DNA alter the corresponding amino acid? Explain.
Answer:
- RNA sequence: UGC
- Amino acid sequence: Cysteine
- Yes, a change in nucleotide will alter the amino acid.
Explanation:
According to this question, a DNA sequence was given as follows: ACG. The process of transcription will produce a RNA sequence from this DNA sequence using complementary base pairing i.e. A-U, G-C etc. Based on this, the mRNA sequence that will result of the DNA sequence above is UGC.
The resulting mRNA transcript is a codon (three nucleotides) that will be used in the process of translation to yield an amino acid. The mRNA sequence: UGC codes for amino acid Cysteine.
- A change in one nucleotide of the DNA will alter the corresponding amino acid because DNA sequence in a particular reading frame is responsible for the production of amino acid. Hence, a slight change in nucleotide might change the reading frame of the sequence and hence give rise to a different amino acid.
Apply: Suppose a template strand of DNA had the following sequence: T A C G G A T A A C T A C C G G G T A T T C A A What would be the complementary strand of mRNA?
The corresponding nucleotide sequence is present on the coding strand. No complementary sequence exists on the template strand.
What changes occur in complementary strand from template?The DNA strand from which the mRNA is produced is known as the template strand. The DNA strand opposite the template strand is known as the coding, or non-template, strand, and it has the same sequence as mRNA except T to U substitutions.
The template strand, one of the two exposed DNA strands, acts as a model for transcription.
The RNA product is essentially identical to the non template (or coding) strand of DNA and is complementary to the template strand.
Therefore, AUG CCU AUU GAU GGC CCA UAA GUU is the complementary strand of mRNA.
Learn more about complementary strand here:
https://brainly.com/question/13768651
#SPJ3
Which of these is an impact of burning coal for energy?
A. acid rain
B. mercury released into the waterways
C. Increased carbon dioxide in the environment
D. all of the above