Which describes the slope of the given line?

A) positive
B) zero
C) negative
D) undefined

Which Describes The Slope Of The Given Line?A) PositiveB) ZeroC) NegativeD) Undefined

Answers

Answer 1

Answer:

C) Negative

Step-by-step explanation:

This is because the top is left and going right

Answer 2

Answer:

negative

Step-by-step explanation:


Related Questions

Zachary can spend at most $100 on new clothes. Write an inequality that represents this situation

Answers

Answer:

x [tex]\leq[/tex] 100

Step-by-step explanation:

less than or equal to= at most

Find C round to the nearest tenth.

Answers

[tex]\textit{Law of Cosines}\\\\ \cfrac{a^2+b^2-c^2}{2ab}=cos(C)\implies cos^{-1}\left(\cfrac{a^2+b^2-c^2}{2ab}\right)=\measuredangle C \\\\[-0.35em] \rule{34em}{0.25pt}\\\\ cos^{-1}\left(\cfrac{90^2+55^2-50^2}{2(90)(55)}\right)=\measuredangle C\implies cos^{-1}\left( \cfrac{8625}{9900} \right)=\measuredangle C \\\\\\ cos^{-1}\left( \cfrac{115}{132} \right)=\measuredangle C\implies 29.4^o\approx \measuredangle C[/tex]

Answer:

C=29.4°

Step-by-step explanation:

[tex]c=50\:ft\\\\a=90\:ft\\\\b=55\:ft[/tex]

Using law of Cosines

[tex]C=cos^{-1}\left(\cfrac{a^2+b^2-c^2}{2ab}\right)\\\\C=cos^{-1}\left(\cfrac{90^2+55^2-50^2}{2*90*55\right)}\\\\C=29.4^{o}[/tex]

~

(x+y) (a+b)-(y+z) (a+b)

Answers

Answer:

[tex](x + y)(a + b) - (y + z)(a + b) \\xa + xb + ya + yb - (ya + yb + za + zb \\ \\ = xa + xb + ya + yb - ya - yb - za - zb \\ = xa + xb - za - zb \\ = a(x - z) + b(x - z) \\ = (x - z)(a + b)[/tex]

Use the volume formula to find the volume of the prism.


A. 21 cubic units B. 42 cubic units C. 27 cubic units D. 9 cubic units

Answers

Answer:

I'm thinking that the answer is option D

Answer the problem 1010+3839

Answers

Answer:

4,849

Step-by-step explanation:

1010+3839=4849

Answer:

4,849

Step-by-step explanation:

Brainliest please

Andrea had twice as many bracelets as her mother. If her mom had b bracelets, how many bracelets did Andrea have?
A. 2 + b
B. 2b
C. b - 2
D. b + 2

Answers

Answer:

your answer is Option B.2b

The answer to your question is 2b

Brainliest if correct

Answers

all you really need to do is find the common denominator and it'll get you an answer for the numerator.

Answer:

13/15

Step-by-step explanation:

You first need to find the common denominator between both 3 and 5, so you have to find the number that would be the best, which is 15. Then you have to multiply the numerator by how many times you went up for that number, for 2/3 would be times 5, and 1/5 would be times 3. Doing this will get you your answer, 13/15.

whats 965 divided by 53 - 42 + 79

Answers

Answer:

10.7222222

Step-by-step explanation:

965 / 53 - 42 + 79

965 / 11 + 79

965 / 90

= 10.7222222

Find the area of this circle. Use 3 for a.
A = 7r2
Hint: The radius (r) is
1/2 of the diameter.
6 in
[?] in?

Answers

good luck buddyyyyyyyyyy

what is the answer to this equation

(7x-1)+(9x+5)

Answers

The answer is (7x-1) 20x + x

a 12. A bicycle wheel has a radius of 40 cm. How many times does it revolve during a journey of 10 km? Give your answer to the nearest 100. [For T, use either your calculator value or 3.142.​

Answers

The bicycle wheel revolving is a illustration of circumference

The bicycle wheel revolves 4000 times

How to determine the number of times?

The given parameters are:

Radius (r) = 40 cm

Distance =10 km

Start by calculating the circumference of the wheel

[tex]C =2\pi r[/tex]

This gives

[tex]C =2 * 3.142 * 40[/tex]

[tex]C =251.36[/tex]

The number of times to cover a distance of 10 km is then calculated as:

[tex]n =\frac{10km}{251.36cm}[/tex]

Evaluate the quotient

[tex]n =3978.35773[/tex]

Approximate

[tex]n =4000[/tex]

Hence, the bicycle wheel revolves 4000 times

Read more about circumference at:

https://brainly.com/question/15673093

1. Devon is young and has just graduated college with her associate's degree. She plans to start saving money for retirement as soon as she starts her new job. By taking 10% of her monthly gross income, Devon is able to contribute (a) $ $587 each month to a retirement plan. The account is expected to earn interest with an APR of 5.25% compounded monthly. Round answers to two decimal places. How much money will be in Devon's retirement account if she continues to make the same monthly investment for 40 years​

Answers

Using the future value formula, it is found that $546,148,903,191,724.25 will be in Devon's account.

What is the future value formula?

It is given by:

[tex]V(n) = P\left[\frac{(1 + r)^{n-1}}{r}\right][/tex]

In which:

P is the payment.n is the number of payments.r is the interest rate.

In this problem, the parameters are as follows: P = 587, r = 0.0525, n = 40 x 12 = 480.

Hence:

[tex]V(n) = P\left[\frac{(1 + r)^{n-1}}{r}\right][/tex]

[tex]V(480) = 587\left[\frac{(1 + 0.0525)^{480-1}}{0.0525}\right][/tex]

[tex]V(480) = 546,148,903,191,724.25[/tex]

$546,148,903,191,724.25 will be in Devon's account.

More can be learned about the future value formula at https://brainly.com/question/5025949

What property is named in the statement 3 (-1 x p) = 3 x (- p)?

Answers

Answer:

jaca

Step-by-step explanation:

Please answer this question as fast ask you can.

Answers

Answer:

D

Step-by-step explanation:

calculated the equation and the expanded form

the answer would be D

The angle of depression from a stationary object to a point on
the ground is the same as the angle of elevation from that
point to the object.
T or F

Answers

Answer: T

Step-by-step explanation:

By the alternate interior angles theorem, the given statement is true.

help please quick. it's 9.1.3 geometric sequences

Answers

Im not completely sure this is correct but I believe the answer might be 68600 but im only like 50/50 sure! So I would double check with another person.

p and q are two numbers such that p > q
When you subtract 5 from p and subtract 5 from q the answers
are in the ratio 9: 1
When you add 20 to p and add 20 to q the answers
are in the ratio 7:3
Find the ratio p:9
Give your answer in its simplest form.

Answers

The ratio p:9 is equal to 50:9 = [tex]\frac{50}{9}[/tex].

System of Linear Equations

System of linear equations is the given term math for two or more equations with the same variables. The solution of these equations represents the point at which the lines intersect.

For solving this equation, firstly, rewrite the information given:

                                          [tex]\frac{p-5}{q-5}=\frac{9}{1} \;(1)\\ \\\frac{p+20}{q+20}=\frac{7}{3} \;(2)[/tex]

From equation 1, you have:

                                        [tex]p-5=9q-45\\ \\ p=9q-40[/tex]

And from equation 2, you have:

                                  [tex]3*(p+20)=7*(q+20)\\ \\ 3p+60=7q+140\\ \\[/tex]

Now, substitute p=9q-40 in 3p+60=7q+140

                                 [tex]3p+60=7q+140\\ \\3*(9q-40)=7q+140\\ \\ 27q-120=7q+140\\ \\ 20q=20\\ \\ q=10[/tex]

If q=10 for p=9q-40,  you will have:

                                [tex]p=9q-40\\ \\ p=9*10-40\\ \\ p=90-40\\ \\ p=50[/tex]

Therefore, the ratio  [tex]\frac{p}{9}[/tex]  is equal to [tex]\frac{50}{9}[/tex].

Learn more about the system of equations here:

https://brainly.com/question/384631

Which of the following correctly identifies the Identity Property of Multiplication?
8x2 =2x8
10x (6x7
20x1=20

Answers

Answer:

20x1=20

Step-by-step explanation:

The product of 1 and any number is the number.

Answer:

20x1=20

Step-by-step explanation:

the identity property says whatever the number gets multiplied by 1 would've that number . hope this helpssss . brainliest ?

Select a box to identify whether each equation has no solution, one solution, or infinitely many solutions.
No Solution
One Solution
Infinitely Many Solutions
- 2x + 3 = - 3x + 2
- 2x + 3= - 2x + 3
OO
- 2x + 3 = 2x + 3

Answers

Answer:

First Equation: One Solution

Second Equation: Infinite Solutions

Third Equation: One Solution

Step-by-step explanation:

Let's solve these equations step by step.

[tex]-2x+3=-3x+2\\[/tex]

Subtract 2 and add 2x

[tex]1=-x\\x=-1[/tex]

The only solution here is -1.

[tex]-2x+3=-2x+3[/tex]

Anytime the equations are the same on both sides, we have infinite solutions.

Add 2x

[tex]3=3[/tex]

Any value of x will satisfy this equation.

[tex]-2x+3=2x+3[/tex]

Add 2x and subtract 3

[tex]4x=0\\x=0[/tex]

The only solution here is 0.

#LearnWithBrainly

what is 5 x 28 / 10 + 100 - 2

Answers

Answer:

The answer is 112

Step-by-step explanation:

((58 x 28) / 10) + 100 - 2

The answer is 112!

Have a good day!

A rancher with 950 ft of fencing wants to enclose a rectangular area and then divide it into four pens with fencing parallel to one side of the rectangle. what is the function A that models the total area of the four pens.

Answers

Answer:

×=4,y=5&/$jfugdji6eg7mghhtbm the best way is to get the latest news

Find the measure of angle A.
9)
A
3x + 6
75°
4x+6

Answers

Check the picture below.

100 POINTS AND BRAINLIEST!!
Which of the following best describes a function? Select all that apply.


the graphed line overlaps itself
every input has exactly one output
the graph of the relation passes the vertical line test
the graph of the relation is a straight line

Answers

Answer:

Every input has exactly one output

Step-by-step explanation:

The easiest definition of function is

If R is relation between (x,y) then

f(x)=y

It simply means that every domain has an unique range

diep buys a load of bread 65 centimeters long. for lunch every afternoon, he cuts 15 centimeters of bread for his sandwich. diep wants to determine the length of the load of bread, i after d days. what is the equation of the scenario? is the graph of the equation continuous or discrete?

Answers

Answer:

Continuous

Step-by-step explanation:

Its continous because after each day you take the same  amount away and due to that it will be continous.

Find the equation of the line which passes through (-2,1) and which is perpendicular
to the line 2x - 4y = -8. State the answer in slope-intercept form and graph.
-

Answers

A line that is perpendicular to a line with slope m has slope -1/m which is the opposite reciprocal of the original slope.

In this case the original line in standard form is

2x-4y=-8

transform this into slop intercept form

-4y=-2x-8

4y=2x+8

y=(1/2)x+2

The slope of this original line is 1/2 therefore the perpendicular line will have slope -2

y'=2x'+b

then substitute in the order pair (x',y')

1=2(-2)+b

b=5

Therefore equation of line is

y=2x+5

The graph is just following this equation!

If you have any questions about my explanation please ask I will answer them to the best of my ability.

The price of an item has been reduced by 80%. The original price was $30. What is the price of the item now?

Answers

Answer:

6

Step-by-step explanation:

80% of 30 is 24 so the price now is 6

how to solve this limit problem?

Answers

Answer:

Привет, как ты?

самый умный я

What can 6/9 be Simplified to

Answers

Answer:

2/3

Step-by-step explanation:

Answer:

2/3

Step-by-step explanation:

6/9 can be simplified into 2/3 by dividing both the numerator and the denominator by the greatest common factor, 3.

The notebook shows the money Reina eamed and spent in the month of April
A positive number represents money eamed. A negative number represents
money spent. Reina wants to find her profit for April

Answers

Answer: 7 dollars

Step-by-step explanation:

You can use a math calculator do 13 + -6

Phoenix has 11200 registered voters. There are two candidates for city council in an upcoming election: A and B. The day before the election, a telephone poll of 400 randomly selected registered voters was conducted. 138 said they'd vote for A, 228 said they'd vote for B, and 34 were undecided. We will assume the actual voting results will be proportional to this survey.

This voter sample suggests that we might expect ______________of the 11200 registered voters to vote for A.

Very confused, and need some clarification. Please explain answer.

Answers

Answer:

3,864

Step-by-step explanation:

138/400×11200

=0.345×11200

=3,864

Other Questions
8mg : 2.5mL= 4mg : x 1. A change to the Constitution:A AmendmentB Elastic clauseO C Implied powersD Eminent domain 3 known families who owned the big corporations in the philippines Roosevelt believed that a president is ________ for the american people. a steward an employer a dictator an inspector When telling a story in the middle of a presentation, it is imperative that you A. take time to describe the setting. B. make it really funny. C. make it about one of the people in the audience so they can relate. D. None of the above Find the values of the variables for the parallelogram.mZ1 = 5y 20X=Y=Z= Please 40 points and will mark as a brainlest What is 155% of 50?a. 83b. 77.5c. 72d. 93 What is the formula for finding t? 1. Find the value for t that's makes the given equation true. 12=-t-11 2. Solve each equation for it's variable.8(m-2)=3(m+3)n-24/8=nPls help 40 points Steve is driving 440 miles to visit the Grand Canyon. He drives at an average rate of 55 miles per hour. Explain how you can find the amount of time it will take Steve to get to the Grand Canyon.Help- Renee is walking to a store that is 2. 5 kilometers from her house. After 700 meters, she stops at her friends houseWhat is the distance that Renee will walk from her friends house to the store? Helen Braddock, ph.d, teaches french at the university.Choose the word or words that should be capitalized. *A. ph.d, frenchD. ph.d, french, universityC. university, ph.dB. teaches, french AGCGTACCCTACAGCGCCCTACTTIs this a frameshift mutation?1.Yes, because the nucleotides/nitrogen bases moved 2.No,because the amino acids did not change3.No,because the nucleotides/nitrogen bases did not move Usually, the three ecological pyramids look similar in shape. Sometimes, a pyramid of numbers does not have the usual pyramid shape, even though the other two pyramids for the same ecosystem do. We reviewed this twice in class. Explain the reason that sometimes a pyramid of numbers does not have a pyramid shape, and be able to draw the shape of this pyramid. How and why can two lethal elements combine to form an essentialcompound for health? What is the first thing Charlotte needs to do after she opens an Excel spreadsheet? A. Select another program B. Select a different template C. Select new blank program D. Select new blank workbook The electrolysis of molten alcl3 for 4. 25 hr with an electrical current of 25. 0 a produces ________ g of aluminum metal PLEASE HELP QUICK!!!How does methamphetamine affect the circulatory system? Why does Christopher dream of most people getting a virus and dying? What does his people-free world look like?The Curious Incident of the Dog in the Night-time