Which excerpt from Act 3, scene ii of Julius Caesar is the best example of Brutus's use of pathos.

Answers

Answer 1

Answer:

Which excerpt from Act 3, scene ii of Julius Caesar is the best example of Brutus's use of pathos.

"Who is here so rude that would not be a Roman? If any, speak; for him have I offended. Who is here so vile that will not love his country?"

Explanation:

Pathos is one of the three literary persuasion devices, it appeals to the audience's emotions, the use that Brutus gives to pathos in this lines from Act III, scene ii of Julius Caesar by William Shakespeare appeal to the love Romans are demanded to have for their country and there is no more emotional topic that patriotism in times of war and conflict.


Related Questions

No links please!!
I really need help with this


Am I correct?
This is concerning the story “Beowulf and Grendel”

Answers

Answer: Supernatural force

Explanation: Your oringinal answer is correct, as Beowulf himself says that God is the reason for his victory.

Silly question I'm too paranoid sorry but is this grammatically correct?

"Impulsive brunette"

Answers

Answer:

Yeah it is

Explanation:

Answer:

Yeah is correct, do u want to give u an explainatiob?

The cross-section of the brick is ……………. in shape.
A. square B. triangular C. circular D. rectangular

Answers

The cross section of the brick is rectangle in shape.
Hope that helps. :)

(d) A............... is a pointi
ng device.​

Answers

Answer:

Mouse

Mouse is a pointing device

Answer:

A Mouse is a pointing device in a computer.

Click True if the underlined indirect speech is correct; otherwise, click False.



Aysha said that she had finished her assignment.
-----------------------------------------------------------------------
This is the indirect speech for:
Aysha said, "I have finished my assignment."


a.True

b.False

Answers

Answer:

p sure its true

Explanation:

6 Rewrite the following sentences using adverbs instead of adjectives to describe the action.
A) her shouts were desperate
B)the collision of the two objects was violent
C)her grip on the controls was tight
D)his speech was quite

Answers

Answer:

She shouted desperately.

The two objects violently collided.

She tightly gripped the controls.

He spoke quietly.

Explanation:

How does the pacing of this passage affect the reader’s interpretation of the text? Select two options.

It creates suspense.
It allows uneventful time to pass.
It establishes a scene with details.
It increases interest in Snowball.
It includes flashbacks that affect plot.

Answers

Answer:

A and C

Explanation:

The test... I took it...

The two options that best describe how the pacing of the passage affects the reader's interpretation of the text are "it establishes a scene with details" and "it creates suspense," which are the first and third options.

What is reader interpretation?

The pacing of a text refers to the speed at which events or information are presented to the reader. It can have a significant impact on the reader's interpretation of the text by affecting their engagement, understanding, and emotional response to the story. In this case, the pacing of the passage includes detailed descriptions of the setting and characters, which helps to establish a vivid scene in the reader's mind.

Hence, correct answers are the reader's interpretation of the text, which is "it establishes a scene with details" and "it creates suspense," which are the first and third options.

Learn more about the reader's interpretation here.

https://brainly.com/question/11279638

#SPJ7

question is incomplete, complete question is below

With one accord they dashed down to the spot. Napoleon, who seldom moved out of a walk, raced ahead of them all. Yes, there it lay, the fruit of all their struggles, levelled to its foundations, the stones they had broken and carried so laboriously scattered all around. Unable at first to speak, they stood gazing mournfully at the litter of fallen stone.

How does the pacing of this passage affect the reader’s interpretation of the text? Select two options.

It creates suspense.

It allows uneventful time to pass.

It establishes a scene with details.

It increases interest in Snowball.

It includes flashbacks that affect plot.

do you have any information about hotels​

Answers

. Hotel rooms are usually numbered (or named in some smaller hotels and B&Bs) to allow guests to identify their room. Some boutique, high-end hotels have custom decorated rooms. Some hotels offer meals as part of a room and board arrangement. In Japan, capsule hotels provide a tiny room suitable only for sleeping and shared bathroom facilities.

Select the common noun(s).
An astronaut moved in to Black Widow's neighborhood.

Answers

Answer:

astronaut and neighboorhood

Your peer wrote this passage. Which does she need to change? Kissing the Blarney Stone gives the gift of eloquently speech. It’s much more dangerous to accomplish this job when the stone is wet because you have to lean out from the castle’s prodigious height, a feat which can cause even the most brave person to shudder.

Answers

The peer needs to change the following in this passage: She should change eloquently because this is an adverb and most brave because that is the incorrect form of this comparable adjective.

Eloquently, which is an adverb that shows the manner in which something happened should be changed and replaced with the adjective, Eloquent.

An adjective is proper because it modifies the noun, gift, in the sentence. Most brave should also be replaced with bravest.

Bravest is the superlative adjective that fits best into the description.

Learn more about adverbs here:

https://brainly.com/question/912194

Yo it’s kind a sus. ££££££££££££££££££££££££££££££££££££ ¥

Answers

[tex]\huge{\colorbox{pink}{What Is?}}[/tex]

[tex]\blue{\rule{99pt}{1000pt}}[/tex]

Suspicious? SUSpicious.. Sus..give me brainliest please

6. Have you ever ……………a phone call in a foreign language? - Yes, I often talk to my customers in Korean and English.
A. done
B. made
C. taken
D. sent
7. Did you …………… well in your exams yesterday? - Not really. I’m very worried about the results.
A. make
B. do
C. get
D. feel
8. The first time I …………… an exhibition was when I was 14 years old.
A. played
B. heard
C. met
D. saw
9. In his spare time, he often …………… with his friends.
A. brings out
B. takes out
C. hangs out
D. thinks out

Answers

Answer:

6 C taken

7 B do

8 D saw

9 C hangs out

can someone help me rc :)​

Answers

1. sentence
2. sentence
3. run-on
4. fragment
5. run-on
6. fragment
7. fragment
8. sentence
9. sentence
10. run-on

McMurphy's arrival was different because he

A) was brought in wearing a straight jacket

B) spoke only to the doctor

C) shook hands with everyone

D) was brought in on a stretcher

Answers

When Randall McMurphy arrived, people could tell that this arrival was different because he C) shook hands with everyone.

In the book, "One Flew Over The Cuckoo's Nest," Randall McMurphy:

Was the protagonist Arrived at the hospital and tried to charm the other patients by shaking their hands

McMurphy came as a different arrival because he came with a defiant tone to the power structure established in the hospital by Nurse Ratched. The reader already notices this behavior when he steps into the hospital and proceeds to shake everyone's hand.

In conclusion, McMurphy shook everyone's hand when he arrived.

Find out more on this book at https://brainly.com/question/11916707.

When I had laid it on the floor

I went to blow the fire a-flame,

But something rustled on the floor,

And someone called me by my name:

It had become a glimmering girl

With apple blossom in her hair

Who called me by my name and ran

And faded through the brightening air.

—“The Song of Wandering Aengus,”
William Butler Yeats

How should a reader change tone to match the change of events between the first half of the stanza and the second half? Answer by completing the sentence.

The reader's voice should change from a descriptive tone to one that sounds
.

Answers

The reader must change the voice from a descriptive tone to a fanciful and ethereal tone.

We can arrive at this answer because:

Tone refers to the feeling that the text promotes during reading.The reader's intonation should change according to this tone, to strengthen it and make the reading even more meaningful.

In the case of the poem shown above, the beginning of the stanza describes what the speaker is doing and therefore the reader promotes a descriptive tone, but the second half of the story shows a more fanciful tone, as it presents something like a dream, like an event more ethereal, which should impact the reader's reading.

More information can be found in the tone of a text on the link:

https://brainly.com/question/1150203

Answer:

Explanation: The "expert verified answer" doesnt even say the anwer so here:)

1. Your statement should be located
at the beginning of your written work.
O concluding
O introduction
O thesis
2
The thesis is used to communicate the
O main points
O supporting details
O personal examples
3
In the video, the speaker compares a
thesis statement to a
O road map
O city road
water slide
AOC

Answers

Number 1 is thesis. Number 2 is main points. I’m not sure what number 3 is.

What literary form used in "Old dan had voiced his challenge to the devil cat."

Answers

Answer:hold onmm

Explanation: 23 is the answer I dont know how bu I guss that is

Is a senior editor at a news company credible, and if so what makes them credible?

Answers

they have more wisdom and life experience, which makes them credible.

Senait’s friend is stressed about an upcoming test. Senait already took the test and got
100%, so she knows all the answers already. Should she:

Answers

Answer: She is a very smart. Like yep alot.... even i cant get 100% marks on an exam(sadly)...

01.10 Writing an Effective Summary Assignment
Directions Read the article below. When you are finished, write a summary to submit for this
igment
Nights and Dragons
- from the memoir of author Abigail Prynne

Answers

Answer:

Answer:

The measure of angle x is 50 degrees

Step-by-step explanation:

we know that

x+y=90x+y=90 ----> equation A

x=2y-30x=2y−30 ----> equation B

solve the system by substitution

substitute equation B in equation A

(2y-30)+y=90(2y−30)+y=90

solve for y

3y=90+303y=90+30

3y=1203y=120

y=40^oy=40

o

Find the measure of angle x

x=2(40)-30=50^ox=2(40)−30=50

o

therefore

The measure of angle x is 50 degrees

"Nights and Dragons" by Abigail Prynne follows a group of diverse heroes on a quest to conquer menacing dragons, exploring themes of courage and friendship in a captivating moonlit realm.

In "Nights and Dragons" by Abigail Prynne, a captivating narrative unfolds where the central theme revolves around the fusion of courage and friendship in the face of adversity.

Through the journey of an unconventional band of protagonists, readers are transported to a moonlit realm teeming with ominous dragons. The tale captures the essence of camaraderie as these unlikely heroes pool their strengths and determination to confront these mythical creatures, interweaving a vivid tapestry of adventure and valor.

The novel's exploration of the symbiotic relationship between darkness and mythical beings adds depth, while the characters' growth and unity provide a poignant reflection on the power of human connection amidst fantastical challenges.

Learn more about "Nights and Dragons" here:

https://brainly.com/question/28832117

#SPJ3

Most probably, your complete question is this:

Write an Effective Summary on "Nights and Dragons" by Abigail Prynne.

I need help writing an effective on "nights and dragons" can Someone help me please?

Dear Editor,

Yesterday, the local Toll Road Committee decided to raise the cost of the toll roads by 35 percent. A toll that used to cost $1.50 will now cost $2.03. The Committee claims to need the money because of budget troubles. I just want to be clear that I don't believe them for a minute. This is nothing but a greedy move by the Committee. Their budget problems are their own fault. If they eliminated wasteful spending, then they wouldn't need to raise the tolls.

The tone of this passage can be best described as
A.
sentimental.
B.
apologetic.
C.
affectionate.
D.
disdainful.

Answers

D. Disdainful. Because the speaker of the text seems unhappy


Select the best answer for the question.
5. Which of the following sentences uses intensive pronouns correctly?
A. Ari and myself are the best students in the class.
B. Myself and James owe you a great deal.
C. Him himself knows the only way to beat the game.
D. She herself will be the one to light the torch.

Answers

Answer:

Answer: D

Explanation:

Because you will need to replace myself with "I" for A in order to make sense,

You will need to replace "myself" with "me" in order to make sense,

"Him himself" doesn't make sense as there's to pronouns that start with him so it'll need to replace the first "him" with "he"

So, D makes sense because it doesn't make any mistakes like the first three answers.

circle each mistake.then rewrite the passage correctly.​

Answers

You need to show us the passage in order to circle its mistakes and rewrite it correctly.

Select all the correct answers.
Pam is writing a literary analysis essay on Giovanni Boccaccio's story "Federigo's Falcon." Which two of the following should she include in the introduction paragraph of her essay?
Even though Monna was unable to fulfill her dying son's wish, she found it in her heart to forgive Federigo after a period of mourning.
An Italian writer and poet, Giovanni Boccaccio grew up in Florence. His mentor, the great poet Petrarch, translated Homer's Iliad and Odyssey at Boccaccio's request.
Despite the tragic deaths of Monna's son and Federigo's falcon, Monna and Federigo find happiness with each other.
"Mother, if you can arrange for me to have Federigo's falcon, I think I would be well very soon." (Boccaccio)
Giovanni Boccaccio's "Federigo's Falcon" is about Federigo, who is in love with Monna. He sacrifices his beloved falcon to prepare a meal fit for her, not knowing that she has come to request the falcon to save her dying son.

Answers

Answer:

the great poet Petrarch, translated Homer's Iliad and Odyssey at Boccaccio's request.

Despite the tragic deaths of Monna's son and Federigo's falcon, Monna and Federigo find happiness with each other.

"Mother, if you can arrange for me to have Federigo's falcon, I think I would be well very soon." (Boccaccio)

Giovanni Boccaccio's "Federigo's Falcon" is about Federigo, who is in love with Monna. He sacrifices his beloved falcon to prepare a meal fit for her, not knowing that she has come to request the falcon to save her dying son.

Answer:



Explanation:



Explanation:

The answers are C & E

C. Despite the tragic deaths of Monna's son and Federigo's falcon, Monna and Federigo find happiness with each other.

E. Giovanni Boccaccio's "Federigo's Falcon" is about Federigo, who is in love with Monna. He sacrifices his beloved falcon to prepare a meal fit for her, not knowing that she has come to request the falcon to save her dying son.

persuasive writing smoking cigarette

Answers

Answer:

Cigarettes, the most common form used for smoking, carries thousands of substances, many which will bring devastating side effects. When one smokes, he or she is breaking down their body into pieces by just the practice of inhaling. The problem of smoking in the society is that it does not simply affect just him or her. This can lead to second hand smoking and onto third hand smoking as well. Although opinions are divided, second hand smoking is just as severe as first hand smoking, as the rate of particle pollution in the air increases up to 900 times more after the first three minutes one has been exposed to the smoke. Smoking can also be destructive to the public as it can happen almost everywhere. Whenever one has a packet of cigarettes.

When the cost of the cigarettes rise nearly 10~20% a year, a high percentage of people, both adults and minors decrease the amount of smoking. Although different for each brand, Australia has been considered the country with the most expensive cigarettes. The fact that a pack is over 15 dollars discourages many against smoking, and most find a way to quit due to the high price. With the income from the raised costs of cigarettes, education and promotion are put into effect. Educating both the younger and older generation helps prevent new smokers from appearing by teaching the downside of cigarettes and the danger it holds to one’s health. Promotions can come in various methods, such as having warning signs and ingredients labelled properly on the cigarette pack. Mass media is a common method used, where dramatic advertisements are shown to depict the side effects of smoking. This could easily be done by simply sending out pictures of damaged lungs, the state of one’s oral systems, and more.

Explanation:

I know this sentence is correct he was the first president not to start a war but I wonder how is this correct ?? whyyy wouldn't it be something like he was the first president who didn't start a war?.

Answers

Answer: There was nothing in the first ages more than rocks or like things that wariors cant use.

Explanation:

ok

21 Answer:
Select the letter of the term that identifies how the underlined
word or phrase functions in the sentence:
A Turkish man made the carpet hanging here.
a. subject c. adjective
b. direct object d. part of a verb phrase
22 Answer:
Select the letter of the term that identifies how the underlined
word or phrase functions in the sentence:
The wool used in this rug is coarse and heavy.
a. subject c. adjective
b. direct object d. part of a verb phrase
23 Answer:
Select the letter of the term that identifies how the underlined
word or phrase functions in the sentence:
The museum plans to display a number of rugs in its new
exhibit.
a. subject c. adjective
b. direct object d. part of a verb phrase
24 Answer:
Select the letter of the term that identifies how the underlined
word or phrase functions in the sentence:
Hanging all of those rugs for display will be quite a job.
a. subject c. adjective
b. direct object d. part of a verb phrase
25 Answer:
The infinitive form of CREATE
a. creating
b. to create
c. created
26 Answer:
The past participle of BUY
a. to buy
b. buying
c. bought
27 Answer:
The gerund formed from DESIGN
a. designing
b. designed
c. to design
28 Answer:
The present participle of DISPLAY
a. to display
b. displaying
c. displayed

Answers

Answer:

21:b 22:d 23:a 24:a 25:b 26:c 27:b 28:a

Answer:

21: c(?)

22:  a(?)

23: b

24: d

25: a

26: c

27: a

28: a

im a bit more sure of the last few, so i hope this helps :)

The work of a whole day into possessive case :​

Answers

Answer:

I hope your day goes great!

Hi Emma, At school, you said that you don't have any plans for the weekend. Well, how about_............ meeting on Saturday morning? I thought maybe we could go ........ a bike to ride. We can go to Moreton-on-Sea, and get something....... eat. I went there by bike last year. In fact, there were six....... us, and we had....... really amazing day. I don't think it will take more for hours go get there and back. Can you let....... know if you can come? Hopefully, I'll see you then! Cheers, Joanna

Answers

Answer:

1. a

2. on

3. to

4. of

5. a

6. me

Explanation:

1. meeting's singular so its article will be "a"

2. go (on), this is a phrasal verb

3. (to) eat, the most suitable preposition in this context

4. six (of) us

5. (a) really amazing day, it's singular

6. me, because it is in first person

giving brainliest ! pls help

Answers

Answer: B

Explanation:

Other Questions
Please help due tomorrow Giving Brainlesst What happened In world war SOLVE HYPOTENUSE LEG-HL-GEOMETRY What is the main idea of Hayess statement?A. He will let the South govern as it wishes.B. He will only look out for Northern interests.C. He will work to unite the interests of North and South.D. He thinks that the division between North and South is important.I think the Answer is "C". 1 2 3 4 5 6 7 8 9 10TIME REMAINING55:47A bill can be either __________, meaning that its contents and the discussion surrounding it are open to anyone, or __________, meaning that most discussions about the bill take place behind closed doors and are not widely known.A.censored . . . openB.hidden . . . privateC.public . . . privateD.public . . . exposedPlease select the best answer from the choices providedABCDMark this and return (If you don't know, don't answer)How can I solve them?1. 44=t722. 18+z=403.18(f)=914. 57=y25. 14=d+(10) In the convention of 1818 what did the U.S obtain from this treaty ?? AC current is produced by which of the following things? A. Remotes B. Generators C. Lights D. Lasers What is the area of a room that is 3 3/4 yards long by 3 1/3 yards wide? In which situation would a photographer most likely use butterfly, or paramount, lighting?landscape photographywildlife photographyaction photographyfashion photography 1 less then the quotent of a number n and 6 Draw the Lewis structures forCalcium bromide, CaBr2 What did farmers want the government to regulate in the late 1800's?1. Steel mills2. Unions3. Railroads4. Banks AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA Order the angles in the triangle above from largest to smallest.Largest1.B2.D3.Smallest Does technology always follow the science,yes or no explain why to choice A body of laws and rules defining the relationship between the government and the people is called:the pacta constitutiona judiciarya treaty Source 1 Pitts' Flash Mob Robberies articleTopic sentence 1 What does this article show about mob mentality? how to factorize 5x^2-20y^2 Sam runs 6 miles in 55 minutes. At the same rate, how many miles would he run in 44 minutes?