Which line of code correctly compares the dragon’s life force to the player’s life force?

when dragon = player:

when dragon + player:

if dragon = player

if dragon > player:

Answers

Answer 1

Answer:

If dragon = player

In coding, the = sign is used to compare things and values, or when doing an arithmetic / mathematical equation. The if statement can run a condition one to infinite times as long as the statement is true. Unlike a while statement, the if statement is a boolean related comparison that does not count as a loop. Don't forget them when making true or false statements, if needed!

-learning code with potato


Related Questions

What links documents, allowing users to move from one to another simply by clicking on a hot spot or link

Answers

Answer:

These are called hyperlinks. A programming language called [tex]HTML[/tex] is responsible for these existing. It stands for hypertext markup language. It can also be used to link documents to each other through these hyperlinks.

how does a computer process data

Answers

Answer:First, data is converted to simple numbers that are easy for a computer to store. Second, the numbers are recorded by hardware inside the computer. Third, the numbers are organized, moved to temporary storage and manipulated by programs, or software.

Explanation:Done:)

1. Data in a smart card can be erased
TRUE
FALSE
2. Internal hard drive is a primary storage in your computer
TRUE
FALSE
3. Optical readers uses a light source to read characters or marks
TRUE
FALSE
4. Magnetic stripe can contain upto 100 characters
TRUE
FALSE
6. Printers are output devices which produces hard copy of information
TRUE
FALSE

Answers

Answer:

false

true

false

true

true

Answer:

Optical memory cards can store up to 4 MB of data. But once written, the data cannot be changed or removed. Thus, this type of card is ideal for record keeping - for example medical files, driving records, or travel histories.

Do you believe that Online Activism results in real change, or do you think it is something that people do to make themselves look good/feel better about themselves? Look for some examples of both in recent history to back your point.
Reflect your findings in a 350 word discussion post. Be sure to link to multiple online sources and add in visual and other multimedia resources to help you make your point. Be sure you credit your sources via a linkback. You are considering other’s ideas, so they need to be credited as such.

Answers

Online Activism results in relatively minimal change. The reason behind this matter is because people generally only take action virtually and not in real life. Although there are fewer opportunities to take action in person, there is a relatively strong difference of seeing someone dying of cancer online and seeing someone in person dying of cancer. This can be summed down to sympathetic disconnect, being how virtualization creates a disconnect between people emotionally and causes the static statement of, "There's nothing I can do" when there's donations and organizations to contribute to always there. It's much easier to feel included in person than online, and accordingly, much more often a reason for people to interact and take actual action.

This software application can be used to create multimedia presentations.

Excel
OneDrive
PowerPoint
Word

Answers

Answer:

The answer is PowerPoint

Explanation:

I had the same question on my test and I got it right.

Good Luck!

Answer:

powerpoint

Explanation:

i took the test

>>> sentence = "Programming is fun!"
>>> _____
'ogr'
A sentence[3:5]

B sentence[2:6]

C sentence[3:6]

D sentence[2:5]

Answers

Answer:

B

Explanation:

i got it right on the quiz

Answer:

It's D.

Explanation:

What http request header is used to identify the acceptable content types that can be returned?.

Answers

Answer:

Accept request-header field.

Explanation:

The Accept request-header field can be used to specify certain media types which are acceptable for the response. It is used to identify the acceptable content types that can be returned.

I hope this helps!

Judith wants sort data about information of students in a school into three columns: first by gender, second by state and third by age. To do so, she can select all the cells in the list, then click the Data tab, click Sort - Sort & Filter group, then click the Add Level button to add the first sorting level. True or False

Answers

Judith can select all the cells in the list, then click the Data tab, click Sort - Sort & Filter group, then click the Add Level button to add the first sorting level and thus it is a True statement.

What is sort data?

Sorting is known to be the act  of putting together data into something that is meaningful  and so that a person can analyze it more better.

Note that Judith using this method through the act of can selecting all the cells in the list, then click the Data tab, click Sort - Sort & Filter group, then click the Add Level button to add the first sorting level is the right way to go about it.

Learn more about  sort data from

https://brainly.com/question/6580581

Which of these jobs would be most appropriate for someone who majors in information systems? A. Managing a group of programers B. Creating a cloud based customer service application app C. Providing telephone tech support D. Designing a database for an online retailer.

Answers

Answer:

B. Creating a cloud based customer service application app

Explanation:

Information Systems is described as an "academic study of various systems encompassing a particular reference associated with the complementary networks and information of the software and hardware that different organizations and people use to collect, create, process, distribute, and filter data.

The information system includes an integrated pair of different components for storing, collecting, and processing data, along with this, it is utilized for providing knowledge, information, and digital products.

In the question above, the correct answer is option-B.

is it possible to get the sims 4 without paying or the free trial?

Answers

Answer:

No

Explanation:

The only way is to pay for the game or do the trial

Select the correct answer.
What is a counter?

Answers

Answer:

Explanation:

A counter is long flat-topped fitment across which business is conducted in a shop or bank or refreshments are served in a cafeteria.

Type the correct answer in the box. Spell all words correctly.
What do modern CPUs use to simulate the performance of multiple processors within one processor?
Modern CPUs use to simulate the performance of multiple processors within one processor?

Answers

Answer:

Modern CPUs contain multiple cores.  Think of it as multiple smaller CPU's on the single CPU chip.  The multiple cores can handle different processes in parallel allowing for multiple programs to be running at the same time.  This is not considered true multi-processing since the architecture still has a single I/O bus and can be subject to a single point of failure.  But the operating system will take advantage of the additional cores as if they were multiple physical CPU's - enhancing performance and productivity.

Explanation:

Select the correct answer,
Which unit of program code takes inputs, performs operations on these inputs, and returns the outputs?
OA
statement
ОВ.
variable
OC.
constant
OD
function

Answers

Answer:

function

Explanation:

took the test

Countries need to engage in trade of natural resources because of distribution in the earth. For instance, countries such as Saudi Arabia trade in because it is in high demand.

Answers

Answer:

unequal, crude oil

Explanation:

Countries need to engage in trade of natural resources because of unequal distribution in the earth. For instance, countries such as Saudi Arabia trade in crude oil because it is in high demand.

Answer: unequal; crude oil

Explanation: Correct on Edmentum

What is the value of the variable result after this code executed?

>>> a = 7
>>> b = 2
>>> c = 0
>>> result = a * b - b / (c+b)
>>> result

output:__?

Answers

Answer:

the answer is 13

Explanation:

I did the test/assignment but all u have to do is copy and paste each line in python or slove like a regular math problem like so,

7 * 2 - 2 / (0 + 2) = 13

result = 13

**sry for late answer***

Which term specifies a type of nonvolatile flash memory that current SSD devices use to retain data when power is turned off or disconnected

Answers

Answer: NVRAM

Explanation: NVRAM stands for Non Volatile Random Access Memory. This is how your computer keeps track of time, for example, when it is powered off and not connected to the internet. Previously we used CMOS chips and CMOS batteries, but now tech is better

Suppose you need to send a PowerPoint file to a friend who is using a very old version of PowerPoint. Which file format should you use?
pptx
pptk
ppt
pptm

Answers

Answer:

ppt

Explanation:

To my knowledge pptx is only available for Microsoft PowerPoint 2013 and up. ppt is the compatibility mode meaning older and newer version alike can open and edit such file

What is a consequence of using open-source software?

A) no support
B) piracy
C) expenses
D) lack of marketing




Note: Sorry if some of the words are wrong. I got all of this off my schools website.

Answers

Answer:

using open source software answer number D lack of marketing

Explanation:

if my answer is correct then mark me as brand list

Answer:

no support

Explanation:

for odyssey users

Precisez la nature de l'information logique ou analogique pour chaque exaple ci dessous

Answers

Answer:

Bonjour pourriez vous m'aider svp ?

Précisez la nature de l'information (logique ou analogique pour chaque exemple ci dessous:

a) poids

b) conformité d'une pièce de monnaie

c) niveau d'eau dans une bouteille

d)porte ouverte ou fermée

e) force de pression

f) présence d'une personne dans une pièce

g)position angulaire

h) température inférieur ou supérieur à 15°C

i) vitesse du vent

j) présence de matériaux métallique à proximité

how many media are used in unimedium technology?​

Answers

Answer:

a lot.

Modern media comes in many different formats, including print media (books, magazines, newspapers), television, movies, video games, music, cell phones, various kinds of software, and the Internet.

A chiropractor is looking at the Security Standards Matrix and believes that it is unnecessary to address the encryption and decryption procedures. What should the chiropractor's office document as a reason for not implementing this standard? Select one: a. None of the answers are correct b. This is a solo practice and there is no need to encrypt information. c. The system used does not enable transmission of information; therefore, the standard is not applicable. d. The office only accepts cash payments; therefore, the standard is not applicable.

Answers

Answer:

Option c. is correct

Explanation:

Chiropractic adjustment is a process (also known as spinal manipulation) in which chiropractors apply a controlled, sudden force to a spinal joint using their hands or a small instrument to improve improve body's physical function.

Chiropractor's office should document the following statement as a reason for not implementing this standard.

The system used does not enable transmission of information; therefore, the standard is not applicable

Joan typed an entire page of her English essay. She is now at the bottom of her document and can’t see the top. What should Joan use to see the top of the document?

Menu
Ribbon
Scroll bar
Tab

Answers

Answer:

scroll bar would be the answer

Explanation:

hope this helps

Answer:

scroll bar

Explanation:

I took the test

Is anyone good a photography? If so pls any help would be great! Brainliest will be given:)

Answers

Answer:

Based on the image I'd have to say the answer is fast shutter speed

Consider the following code:


for r in range (10, 60, 10):

print("Hello")

How many times is the word "Hello" output?

PLSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS ANSWER ISTG

Answers

Answer:

5 times

Explanation:

Noah is creating a startup. He uses the website Upwork to hire freelancers in India and in the Ukraine to work for him. This is an example of:
1.industrialization.

2.automation.

3.outsourcing.

4.Moore’s Law.

Answers

Answer:

outsourcing

Explanation:

Should spreadsheets be used to maintain a checkbook? Question 1 options: YES NO.

Answers

The spreadsheets should be used to maintain the checkbook. The option 1 of the problem is correct.

What is spreadsheet?

Spreadsheet is the electronic sheet in which the data can be arranged and saved for the future use. This data in a spreadsheet is arranged in the rows and the column of the spreadsheet.

Applications of spreadsheet are listed below.

Arrangement of the data in a proper format.Create reports and the charts to better understanding the data.Used in business, and account maintenance.Used for the simple as well as complex numerical calculations.

The spreadsheet is the best way to maintain a check book because with the help of spreadsheet, many formulas in each cell can be applied.

Hence, the spreadsheets should be used to maintain the checkbook. The option 1 of the problem is correct.

Learn more about the spreadsheet here;

https://brainly.com/question/4965119

What are the text boxes in a slide known as?

Answers

Ghhhbbnbvuughighohkhigigjvgg
i’m not fully sure but i think: A typical PowerPoint slide lets you type text in the Title text box or the Subtitle text box.

what does FEA for digital technology mean?


thanks for your time!!

Answers

Answer:

Finite Element Analysis

Explanation:

hope that helped ,brainliest if u dont mind

fea= finite element analysis

Computers that communicate over a network must follow certain ___ to ensure that the transmission is sent properly and understood.

Answers

Computers that communicate over a network must follow certain protocols or rules, in order to ensure that data are transmitted properly and understood.

What is a protocol?

A protocol can be defined as a formatted blocks of data that have been designed and established to obey a set of standard rules (conventions) such as the Transmission Control Protocol and Internet Protocol (TCP/IP).

In Computer networking, all computers and other network devices that communicate over a network must follow certain protocols or rules, in order to ensure that data are transmitted properly and well understood by end users.

Read more on protocol here: https://brainly.com/question/17387945

Though there are no specific federal laws for cyberbullying, in some cases cyberbullying
overlaps with __________
harassment.

Answers

cyberbullying overlaps with discriminatory harassment
Other Questions
3 known families who owned the big corporations in the philippines Roosevelt believed that a president is ________ for the american people. a steward an employer a dictator an inspector When telling a story in the middle of a presentation, it is imperative that you A. take time to describe the setting. B. make it really funny. C. make it about one of the people in the audience so they can relate. D. None of the above Find the values of the variables for the parallelogram.mZ1 = 5y 20X=Y=Z= Please 40 points and will mark as a brainlest What is 155% of 50?a. 83b. 77.5c. 72d. 93 What is the formula for finding t? 1. Find the value for t that's makes the given equation true. 12=-t-11 2. Solve each equation for it's variable.8(m-2)=3(m+3)n-24/8=nPls help 40 points Steve is driving 440 miles to visit the Grand Canyon. He drives at an average rate of 55 miles per hour. Explain how you can find the amount of time it will take Steve to get to the Grand Canyon.Help- Renee is walking to a store that is 2. 5 kilometers from her house. After 700 meters, she stops at her friends houseWhat is the distance that Renee will walk from her friends house to the store? Helen Braddock, ph.d, teaches french at the university.Choose the word or words that should be capitalized. *A. ph.d, frenchD. ph.d, french, universityC. university, ph.dB. teaches, french AGCGTACCCTACAGCGCCCTACTTIs this a frameshift mutation?1.Yes, because the nucleotides/nitrogen bases moved 2.No,because the amino acids did not change3.No,because the nucleotides/nitrogen bases did not move Usually, the three ecological pyramids look similar in shape. Sometimes, a pyramid of numbers does not have the usual pyramid shape, even though the other two pyramids for the same ecosystem do. We reviewed this twice in class. Explain the reason that sometimes a pyramid of numbers does not have a pyramid shape, and be able to draw the shape of this pyramid. How and why can two lethal elements combine to form an essentialcompound for health? What is the first thing Charlotte needs to do after she opens an Excel spreadsheet? A. Select another program B. Select a different template C. Select new blank program D. Select new blank workbook The electrolysis of molten alcl3 for 4. 25 hr with an electrical current of 25. 0 a produces ________ g of aluminum metal PLEASE HELP QUICK!!!How does methamphetamine affect the circulatory system? Why does Christopher dream of most people getting a virus and dying? What does his people-free world look like?The Curious Incident of the Dog in the Night-time WHO IS REALLY GOOD WITH SPANISH?Es necesario que Emma ____ (ir) a su clase de gimnasia todas las semanas.ireiravavayaEs bueno que yo ____ (estar) preparada.esteestestestar If you divide -16 into 5 equal parts, how much is each part equal to?