Which lines from “I, Too” best develop an uplifting tone?
A. I too sing America /I am the darker brother.
B. But I laugh /and eat well /and grow strong.
C. And be ashamed- I, too, am America.
D. Nobody’ll dare/ Say to me.

Which Lines From I, Too Best Develop An Uplifting Tone?A. I Too Sing America /I Am The Darker Brother.B.

Answers

Answer 1
The answer is actually (B) I believe,

- to laugh eat well & grow strong are all uplifting representations.
Answer 2

The lines from “I, Too” best develop an uplifting tone B. But I laugh /and eat well /and grow strong.

What are the use of uplifting representation?

The English Textual Concepts surely define the idea of representation. The depiction of a thing, man or woman or concept in written, visual, executed or spoken language.

In representing we make selections from the language provided with the aid of using those modes.But I laugh and eat well and grow strong ar all the uplifting tone as thy shows about the uplifting tone.

Read more about the uplifting tone:

https://brainly.com/question/25627023

#SPJ2


Related Questions

Look at the examples in highlighted text in the passage. Which one supports the theme Of knightly virtue?

Answers

The example that supports the theme of knightly virtue is: B.  "l am bound by my vow to do so,". . . .

A knight is a person who is appointed to serve a king or a senior soldier. Courage and loyalty are qualities that are required of knights.

In the example chosen above, we see that the knight states that he is bound by his vow to take a certain action. In so doing, he displays loyalty to his superior.

So, option B is an example that supports the theme of knightly virtue.

Learn more about knights here:

https://brainly.com/question/10941192

How can you tell if someone is talking in first person or third person point of view?

Answers

Answer:

If someone is talking in first person, they use words such as "I, me, or we." If someone is talking in third person, they use words such as "they, she, or he."

Explanation:

I hope this helps!!

Someone is talking in first person point of view when they use any pronouns that indicate they are telling a story that they are in. Examples of these pronouns include "I", "me", "we", and so on. Someone is talking in third person if they seem to be telling a story that they were not in, and these pronouns include "they", "he", "she", "them" but not "me" because the third-person narrator is merely someone who observes and tells the story and not someone who is actually part of the story, meanwhile first person narrators are part of the story.

Hopefully this helps, and I apologize if it doesn't.

Which use of pacing best creates a feeling of nervousness?
-
O A. From somewhere in the far distance, she heard a sound - more of
a suggestion of a sound than anything she could make out
distinctly.
O B. Her eyes perked up as one sound arose, then eventually another, in
waves of noise that went on forever.
O C. She heard several sounds in a row, then listened for more.
D. A sound. Her ears perked up. Another. What was it? Finally, a third,
louder than the others.

Answers

Answer:

It's D

Explanation:

i just did it

The statement that creates a feeling of nervousness by use of pacing is "A sound. Her ears perked up. Another. What was it? Finally, a third, louder than the others."

What is pacing?

Pace, or pacing, in literature refers to the rate at which a story is told rather than the rate at which the story takes place. The length of the scenes, the speed with which the action moves, and the speed with which the reader is given information all influence the pace. It is also influenced by the story's genre: comedies move faster than dramas, and action adventures move faster than suspense.

A slow pace is typical of many novels rejected by publishers, as well as those that make it into print but not into the hearts and recommendations of readers.

Therefore, the correct answer is option D.

To learn more about pacing, click here:

https://brainly.com/question/4957057

#SPJ2

CAN SOMEONE PLEASE HELP ME I HAVE NO CLUE WHAT TO WRITE

Answers

Answer: Pretend you’re one of the characters writing an autobiography. Maybe do some reasarch about the beginning of their life and then explain how the characters personality and traits developed. The whole point of the assignment is to be creative without straying too far from the actual characters life so make something interesting. If you really care about the grade I would make a PowerPoint because it’s the best low effort high reward presentation, but a short autobiography thing would work as well. Good luck!

Why does Long use colloquial language?(every man a king)
O A. To seem more relatable to his audience
O B. To highlight the complexity of the topic at hand
C. To sound more educated than he actually is
D. To distinguish himself from his listeners

Answers

Answer:

B) To highlight the complexity of the topic at hand

Explanation:

He used the lectures to criticize the concentration of riches in the hands of a few individuals and to emphasize the hardship of the man poor in his own state, a populist politician. A portion of the "every man is a king" speech read.

Answer:

A

Explanation:

I don't think the other guy even knows what colloquial language is lol. Colloquial language is when you talk and use words that are used in a certain place and time. For example, "I'm cranking 90's Morty!" Is an example of colloquial language. If you don't know the terminology, you won't get what Rick is saying. But if you know what cranking 90s means, then you can relate to and understand this quote.

what is wrong with this sentence?
My body kept telling me to run, but my feet were stuck to the ground.

Answers

Theres nothing to pull the reader in. Like theres nothing to grab there attention. Maybe you could do something like this: My body would't let move, i wanted to run, but it felt like i was stuck to the ground like someone buried my feet into the soft but heavy dirt

There are No mistakes!

Fast pls!
What is the relationship between the genre of a work of literature and the author’s purpose?
There is no relationship between genre and purpose.
An author has no choice about genre but unlimited choice about purpose.
An author will choose the genre whose qualities best suit his or her purpose.
The genre of the work largely determines the author’s purpose.

Answers

Answer:

An author will choose the genre whose qualities best suit his or her purpose.

Explanation:

There is a clear correlation between genre and purpose, and purpose determines genre, not the other way around.

The genre of a work of literature and the author's purpose are closely related.

What is the relationship between the genre of a work of literature and the author’s purpose?

The genre refers to the category or type of literature, such as poetry, drama, or novel, while the author's purpose refers to the reason for writing the work, such as to entertain, inform, persuade, or express personal feelings.

The choice of genre can reflect the author's purpose. For example, if an author's purpose is to inform or persuade, they may choose to write non-fiction, such as a history book or a political essay. If their purpose is to entertain, they may choose to write fiction, such as a romance novel or a mystery.

Additionally, within each genre, there are different conventions and expectations that can influence an author's purpose. For example, in a detective novel, the author's purpose may be to entertain the reader with a gripping story and surprise ending, while in a historical novel, the author's purpose may be to inform the reader about a particular period in history.

In summary, the genre of a work of literature and the author's purpose are intertwined, with the author often selecting a genre that aligns with their purpose and using the conventions of that genre to achieve their intended effect.

Learn more about author’s purpose here

https://brainly.com/question/2437871

#SPJ7

What important element of Benjamin Franklin's character does this passage from his autobiography reveal?

There was a salt-marsh that bounded part of the mill-pond, on the edge of which, at high water, we used to stand to fish for minnows. By much trampling, we had made it a mere quagmire. My proposal was to build a wharf there fit for us to stand upon, and I showed my comrades a large heap of stones, which were intended for a new house near the marsh, and which would very well suit our purpose.

a-his shyness
b-his ingenuity
c-his sentimentality
d-his dishonesty

Answers

The important element of Benjamin Franklin's character that is revealed in this passage from his autobiography is: b- His ingenuity.

The quality of ingenuity is the attribute of creativity and innovation. Someone who is ingenious is always open to new ideas that will change the way things are done.

We see this attribute in Benjamin Franklin who was able to make a proposal that a wharf be built at the mill-pond.

His ingenuity is thus revealed in the fact that he had new and exciting ideas.

Learn more about Benjamin Franklin here:

https://brainly.com/question/509859

Answer:his ingenuity

Explanation:

Which rhetorical feature included in the ""Bill of Rights"" is not included in the excerpt from ""Federalist Paper No. 51""?

Answers

Answer:

Federalist Paper 84 argued that the Constitution didn’t need one immediately, but amendments could be added later. Read more about the question “why do we need the Bill of Rights” and Federalist 84. Federalist 84 Addresses Objections. One of the primary objections to the Constitution was that it contained no bill of rights. The Federalist ...

Explanation:

I NEED HELP 50POINTS

Answers

Answer:

Ok I will help u

Explanation:

Hope this helps

May I get braineist pls?

what are you taking about

That man over there says that women need to be helped into carriages, and lifted over ditches, and to have the best place everywhere. Which 1850s social norm is reflected in the excerpt about white women? the idea that women should look delicate and be handled delicately the idea that women should avoid too many intellectual pursuits the idea that women should devote themselves to becoming a mother the idea that women should be more practical and less sentimental.

Answers

Answer:

The idea that women should look delicate and be handled delicately.

Explanation:

This idea is reflected by the passage.

Answer:

Just took test it's A: The idea that woman should look delicate and be handled delicately

for what does been referred to choose the word that completes the sentence​

Answers

Answer:

plates

Explanation:

The previous sentence mentions Rami going to the basement to get mugs and plates. This means "them" could refer to either mugs or plates. However, it makes the most sense for "them" to mean plates as this is what we eat food off of.

Therefore, plates is the correct answer choice.

Is deception ever acceptable behavior? If so, when? If not, why not?...

Answers

Answer:

In general, deception is not acceptable in human studies. Explanation:Occasionally, it is necessary to mislead the participants who are subjects of a study in order to obtain unbiased information. The Institute Review Board (IRB) must review very carefully the proposals that use deception or misrepresentation.

Answer:

Deception is the act or practice of deceiving—lying, misleading, or otherwise hiding or distorting the truth. It should never be acceptable because you are leading someone to think something is true when the exact opposite might be true.

Hope that helps

Which of the following is an example of a rhetorical question?

Will this class ever be over?
Can you do that for me?
Why did he leave his phone at home?
When are we eating?

will give brainliest to right awnser

Answers

Answer:

Will this class ever be over?

Explanation:

A rhetorical question is a question that's asked merely for emphasis with no answer expected.

Which two words from "The Raven" by Edgar Allan Poe are examples of internal rhyme?

Answers

Answer:

The words in the line from Edgar Allan Poe's "The Raven" that create internal rhyme is peering and fearing.

Explanation:

Deep into that darkness peering, long I stood there wondering, fearing,

An internal rhyme is the type of rhyme that rhymes two words which one is usually in the middle of a line and the other at the end of the line or middle of the next line.

Deep into that darkness peering, long I stood there wondering, fearing,

Doubting, dreaming dreams no mortal ever dared to dream before;

  But the silence was unbroken, and the stillness gave no token,

  And the only word there spoken was the whispered word, “Lenore?”

This I whispered, and an echo murmured back the word, “Lenore!”—

          Merely this and nothing more.

how many ghosts visit ebenezer scrooge in a christmas carol

Answers

Answer:

Explanation:

In Charles Dickens's A Christmas Carol, Ebenezer Scrooge is visited by four ghosts on Christmas Eve: Jacob Marley, and the spirits of Christmas Past, Present and Future.

Answer:

Four ghost

Explanation:

Jacob Marley, and the spirits of Christmas Past, Present and Future.

It certainly was cold, was his thought. When he got back to the States he could tell the folks what real cold was. He drifted on from this to a vision of the old-timer on Sulphur Creek. He could see him quite clearly, warm and comfortable, and smoking a pipe.
"You were right, old hoss; you were right," the man mumbled to the old-timer of Sulphur Creek.
–“To Build a Fire,”
Jack London
Read the passage. Then, complete the statements.
Through all the conflicts he faces, the man learns that he should have .
This points to the theme that

Answers

Answer:

It certainly was cold, was his thought. When he got back to the States he could tell the folks what real cold was. And she drifted on from vision of the old-timer on Sulphur Creek. He could see him quite clearly, warm and comfortable, and smoking a pipe.

"You were right, old hoss; you were right," the man mumbled to the old-timer of Sulphur Creek.

Explanation:

Hopeeee itsss helpsss ^_^

Answer:

1. listened to the old man

2.ignoring advice from others can lead to disaster

Explanation:

Public parks are paid for through taxes. People should never have to pay to use them.
agree or disagree?

Answers

Honestly I am at a crossroads because I do believe parks should eventually have more play equipment but I don’t think taxes will always be enough to take care of the parks. I agree that everyone should be able to go to the park whenever they want to because some people consider certain parks their safe spot where they can be alone without anyone they know bother them and a place for them to relax.

why does Winston decide not to go out into the open?

Answers

Answer:

picture??

Explanation:

50. Look at the state of the gate. It needs …
as soon as possible.
A, to repair
B. repairing
C. being repaired
D. be repaired

Answers

Option B is the answer.

Look at the state of the gate. It needs repairing as soon as possible.

Answer:

to repair

Explanation:

D can also be right if we add to before the 'D' statement

what is the correct meaning of the word emphatically

Answers

Answer:

To do something forcefully or To do something without a doubt

Explanation:

Work out
2
3
4
+
1
2
3
Give your answer as a mixed number where appropriate

Answers

Answer:

what do you mean

Explanation:

Chromosomes on a karyotype are arranged from largest to smallest.


True

False

Answers

Answer:

False

Explanation:

Chromosomes on a karyotype are arranged from smallest to largest.

Character vs character.


What is that ? PLSS HELP

Answers

Answer:

In this type of conflict, the main character is having a problem with another character in the story,human or not.

Character vs character is when two characters are struggling against each other. Its also known as man vs man conflict.

Why is it important to the theme of the strength of mothers that the last scene takes place in the kitchen?

Answers

Answer:

The theme of the story is to feel grateful for your parents. Alfred realizes his mother is getting old and she was nervous for him when she was drinking tea. He could see all the years of her life.

Explanation:

what is the correct meaning of the word abdide

Answers

Answer:

Explanation:

accept or act in accordance with (a rule, decision, or recommendation)

Abide means to accept, or to act according too; agree.

For example: "I said I would Abide by their rules" - I would accept/follow their rules.

1. Explain the definitions of the four income groups.
2. Identify two countries within each of the four income categories
3. Why do you think the U.S. is one of the few countries to fall within the high-income category?
4. Compare poverty in the U.S. to poverty in low-income economies.

Answers

Based on the World Bank definition, the four income groups are the groups in which various countries are categorized based on how their economic growth, inflation, exchange rates, and population growth influence GNI per capita.

2. The two countries within each of the four income categories are:

Low-income groupAfghanistanBangladesh

Lower-middle income groupBeninTajikistan

Upper-middle income group BrazilMauritius

High-income countries income groupUnited StatesSwitzerland

3. Typically, the U.S. is one of the few countries to fall within the high-income category because they have good economic growth, lower inflation rates, favorable exchange rates, and adequate population growth that positively impact their GNI per capita.

4. When comparing poverty in the U.S. to poverty in low-income economies, it is always concluded that poverty in the United States is less extreme.

There is no extensive famine and drastic stunting of children in the US, unlike low-income countries.

Hence, in this case, it is concluded that Income groups are one of the ways to categorize the countries of the world based on socio-economic statistics.

Learn more about Income Groups here: https://brainly.com/question/25221038


1. Which word or words go with easier?
a)mediocre

(b) convenient
(c) ravenous
(d) captive
the litary

2. Which wart or words go with less of freedom
(a) course
(b)accompany
(c)bondage
(d) captive
3. Winch word or words go with helpful?
(8) prefer
(b) linger
(c) interpret
(d) beneficial
4. Which word or words go with happiness?
(a) supplement
(bl bliss
{c) ecstasy
(d) monotony
5. Which word or words go with slow?
(a) linger
b) accompany
(c) supplement
(d) saunter
6. Which word or words go with clumslly done?
a) retrieve (b) bungle
c) convenient
(d) inept
7. Which word or words go with wide open spaces?
(a) captivity (b) expanse
(c)territory
(d) supplement

Answers

Answer:

1: Which word goes with easier: Convenient.

2: Which word or words go with less freedom: Captive.

3: Which word or words go with helpful: Beneficial.

4: Which word or words go with happiness: Bliss.

5: Which word or words go with slow: Saunter.

6: Which word or words go with done clumsily: Inept.

7: Which word or words go with wide open spaces: Expanse.

Explanation:

You had a few grammar errors, so I fixed them! Hope this helps!

Answer: 1 (b), 2 (d), 3 (d), 4, (b) & (c) both mean the same thing, 5 (d), 6 (b), 7 (c)

Explanation: Not sure about 6 heh

Read the excerpt from Gilgamesh: A New English Version. "Let your heart inspire you to be joyous in battle, to forget about death. If we help each other and fight side by side, we will make a lasting name for ourselves, we will stamp our fame on men's minds forever. " Which sentence best states the theme of the excerpt? Gilgamesh ignores the threat of death. People's actions determine their legacy. Fighting for one's country is important. With reassurance, Enkidu prevails.

Answers

The corrective and the most suitable statement from the given phrase will that the Gilgamesh forget the Threat of the death and they want every soldier to enjoy the war .

The Gilgamesh  was the great king for their people and for their soldiers, he want to protect them at any cost . Gilgamesh  was in search of immortal and want to remove the fear of war from the heart of the soldiers.

The Gilgamesh  as also consider as the half god as his other was belongs to gods, and he was so powerful that he had no fear of war and also ready to fight with the big countries.

For more information on Gilgamesh , please refer the below link :

https://brainly.com/question/16553774

Answer:

the answer is b i just took the test

Explanation:

Past participle of go

Answers

Answer:

gone.....................

Answer: Gone

Explanation:

Other Questions
Can someone please take the time out of their day and help me with this question A town has a population of 5000 and grows at 3. 5% every year. To the nearest tenth of a year, how long will it be until the population will reach 7300?. when the tides are especially weak it is called a _____ tide question 2 please answer Develop an argument that explains whether the federal bureaucracy operates with sufficient checks and balances or whether it has too much discretionary authority to be a fully democratic element of government? Decide if the following sentence is grammatically CORRECT or INCORRECT.Pierre: Est-ce que tu veux venir au cinma avec moi?Alice: Non merci, je ne veux pas en aller. CorrectIncorrect Alisha has a fiveyear car loan of $15,000 with an interest rate of 6 percent. If the interest is compounded annually, how much will she pay in total for her car? A ____ called _____ is found inside most plants cells y is directly proportional to x2. If y=8 when x=2 find y when x=3 Find the area of the figure.7cm8cm11cmArea is ___ square cm? Katerina is a real estate agent. Katerina works on a 4% commission. She earns a $4200commission. What was the value of the house that she sold? Solve the following system: 5x + 4y = 6 -2x 3y = -1 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Marla earns an 8% commission on a house that she sells for $450,000. How 1 pointmuch does she earn in commission for this sale? ivan earns $8 each time he walks his neighbors dog.He already walked the dog 5 times forensic anthropology what bones can tell us questions answer key what would a duty ethicist say about spanking What this book is aboutNapoleon's Crimes pls help Determine if each pair of ratios is equivalent or not. 6/8 21/36 Why is the tea ceremony of japan is important to modern life? Write in your own words 8 sentences please help me someone its very important:(