Which of following countries are examples of nation states?

Japan and Iceland

Portugal and Brazil

England and the United States

The United States and Australia

Answers

Answer 1
Go with Japan and IceLand
Answer 2

Answer:

I'd go with England and the United States.

Explanation:

Hong KongBermudaGreenlandPuerto RicoNorthern Ireland, Wales, Scotland, and England are non-sovereign parts of the United Kingdom.

Related Questions

The peasensts (the lower class) won the Febuary Revolution with their own desire and conviction. How far do your agree

Answers

Answer:

I agree alot tbh, because the peasants were being treated unfairly, and were cruel and insulting to the peasants, so if they got their desire, it's great :3

Explanation:

:3

Which Civil Rights leader stated these words:"Black people shouldn't be non-violent unless white people are going to be nonviolent."

Answers

Answer:

It's either MLK or Malcolm X

CAN SOMEONE HELP ME PLEASE

Answers

Answer:

Yes jhgguhvggvvvhvhhvggfffgvbhj

Answer:

I dont really know sorry....

HELP!!!!!!!

CHOOSE whether each quote is an argument for the North or the south.

Answers

I think the first one is South, and the second one is North

Name the positions of the presiding officers of the House of Representatives and the Senate.
Explain which one has more power

Answers

Answer:

The answer is below

Explanation:

1. The presiding officer of the House of Representatives is SPEAKER of the House

The presiding officer of the Senate is Vice President

2. The presiding officer of the Senate is more powerful than the presiding officer of the house because of these reasons:

The position is the first in a line of succession to President of the United States.

He also acts as the tiebreaker to the final decision made in the senate.

The Senate has the final legislative approval to a bill, in which the presiding officer leads in the approval process.

The Mandate of Heaven meant that"
” had a divine right to rule

Answers

Answer:

Emperor

Explanation:

The Mandate of Heaven was the right to rule given to Chinese emperors by gods.

HELP URGENT!!!!!!


What did Roosevelt, Churchill, and Stalin agree to at the yalta conference.

Answers

Answer:

At Yalta, Roosevelt and Churchill discussed with Stalin the conditions under which the Soviet Union would enter the war against Japan and all three agreed that, in exchange for potential crucial Soviet participation in the Pacific theater, the Soviets would be granted a sphere of influence in Manchuria following Japan's surrender.

Who do Southerners need in order to grow their cotton crops as they grow more and more cotton out west?

Answers

They needed slaves to do the work in the plantations as more cotton was being grown. They also needed cotton gins to speed up the process of making cotton into other things.

* The primary goal of the American Temperance Society was to​

Answers

Answer: B

Explanation:

hope this helps and pls mark brainliest :)

what did the japanese assume the u.s would do after they attacked pearl harbor

Answers

Answer:Initially, the Japanese believed they had scored a key victory on December 7, 1941. But thanks to the heroic salvage effort, the great majority of the U.S.

Explanation:

Why did the U.S. Navy reposition its Pacific Fleet to Pearl Harbor?

Answers

Explanation:

In 1940, Roosevelt moved the Pacific fleet to the naval base at Pearl Harbor as a show of American power. ... Japan's leaders hoped that a surprise attack on Pearl Harbor would destroy American resolve and cripple the American navy for at least six months, giving Japan time to consolidate its new empire

The baby boom is the second largest generation in history

True or false

Answers

Answer:

This statement is true.

Explanation:

Millennials overtook the baby boomer generation most recently making it the world's second largest generation of all time.

Hope this helped! (◞≼☉≽◟◞౪◟◞≼☉≽◟)

What contributed most to President Bush losing the election to Bill Clinton in 1992?
the failing economy
the conflict with Panama
his conservation measures
the outcome of the Gulf War

Answers

Answer:

A - The failing economy

Explanation:

edge 2021

Answer:

A

Explanation:

the failing economy

Why did the Framers establish the Legislative Branch in Article I of the Constitution?
O A. They felt people would more easily accept a strong judicial branch if there was a legislative check on its power.
OB. They felt people would more easily accept a strong executive branch if there was a legislative check on its power.
OC. They felt people would more easily accept a strong legislative branch if it was split between two separate houses.
OD. They felt people would more easily accept a strong military if it was controlled by the legislative branch.
Reset
Next

Answers

"The Framers establish the Legislative Branch in Article I of the Constitution because they felt people would more easily accept a strong executive branch if there was a legislative check on its power." The correct option is B.

The Federal Convention needed Congress to for-ward the Constitution on to the state ratification conven-tions. People would be more comfort-able with a strong executive branch after they saw legis-lative checks on executive powers. Congress wo-uld be the first branch of the new govern-ment.

The legislative branch has the power to app-rove Presidential nomi-nations, control the budget, & can im-peach the President and remove him or her fr-om office. The correct option is B.

To know more about legislative branch click below:

brainly.com/question/28635209

#SPJ1

Which statement best describes the connection between World War II and the spread of communism in Europe? A B C D
A. After World War II, the Soviet Union attacked its European allies and replaced their governments with a communist one.
B. The Soviet Union pushed westward against the Germans, occupied the nations it passed through, and installed communist governments.
C. The economies of Eastern Europe were devastated by the war, and they believed that a shift to communism would result in a fair distribution of wealth.
D. The Soviet Union demonstrated great strength in helping to defeat Germany, and some countries attributed that strength to communism and changed their governments.

Answers

Answer:

B

Explanation:

During and after WW2, the Soviets steamrolled through Eastern Europe and onto Berlin which led to post-war Eastern Europe being occupied by the USSR which led them to install communist governments that became essentially sattelite states to the Soviet Union.

The connection between World War II and the spread of communism was when the Soviet Union occupied the nations it crossed and set communist governments.

World War II

Near the end of World War II, the Soviets crossed many nations and established a communist government.

USSR increase its hold under the Red army.

Germany was split between West and East Berlin.

Iron Curtain was necessary after World War II to seal the USSR from other non-communist countries.

Thus option B is the correct answer.

Learn more about World War II here:

brainly.com/question/1307652

Was wondering some examples of nationalism vs patriotism?

Answers

Answer: An excess of patriotism in the defense of a nation is called chauvinism or jingoism. The difference between patriotism and nationalism is simple - a patriot loves his country and is proud of it for what it does whereas a nationalist loves his country and is proud of his country NO MATTER WHAT IT DOES.

Explanation:

How were immigrants treated in the 1920s? Why could their treatment be seen as a “contradiction”?


Please help I will give brainliest to the best answer

Answers

They were blamed for spreading disease and slum housing, as well as rising crime rates, alcoholism and gambling

can someone tell me this

Answers

Answer:

avoid letting the child face negative consequences

What are the four factors of production in a socialist economy

Answers

Answer:

labor, capital goods, natural resources, and entrepreneurship.

What area did explorers from Portugal focus on exploring? (4 points)

a
Between Africa and India

b
Between Africa and Asia

c
Between Europe and South America

d
Between Europe and North America

Answers

B. India had many spices China had silk and there had also been many port cities in Africa so ships could get to Asia.

Which caricature
criticizes the
ideologies of
liberalism and which
ideologies of
socialism? Explain
why you think so.

Answers

Answer:

The first caricature is criticizing the ideology of socialism because it depicts Karl Marx, one of the intellectual founders of that system, as the guiding force that is leading his followers, the socialists, to the abyss.

The second caricature criticizes liberalism. Liberalism is associated with the free market (classical liberalism and libertarian liberalism), and such system has a tendency to facilitate the accumulation of wealth, and the growth of economic inequality. That is why the second caricature is depicting a fat individual surrounded by bags of money.

..............................

Answers

Answer:

is smol

Explanation:

qwq

After Lincoln issued the Emancipation Proclamation, Great Britain and France
O sent troops to help the South.
O decided not to support the Confederacy.
O sent troops to help the North.
O ended slavery in their own countries.

Answers

Answer:

B. Decided not to support the confederacy.

30 POINTS!!!!! PLEASE ANSWER

1. The Bolshevik Revolution of 1917 in Russia was caused in part by *

a forced famine in Ukraine
the failure of Czar Nicholas II to come to Serbia’s aid
a shortage of military supplies and food during World War I
the Sepoy Rebellion
Other:

2. Joseph Stalin’s policies in Ukraine during the 1930s directly resulted in *

agricultural self-sufficiency
widespread starvation
the development of cottage industries
the use of subsistence farming techniques

3.Which event led Russia to withdraw from World War I and surrender a significant amount of territory to Germany? *

assassination of Austro-Hungarian Archduke Franz Ferdinand
seizure of power by the Bolsheviks
sudden death of Vladimir Lenin
meeting of the Yalta Conference

4. A major purpose of five-year plans in the Soviet Union was to *

increase the production of steel and machinery
produce more consumer goods
eliminate central economic planning
seek direct foreign investment

5. A primary objective of the New Economic Policy (NEP) in the Soviet Union was to *

promote private ownership of heavy industry
organize support for educational reforms to improve literacy
coordinate efforts to end World War I
gain stability by increasing production

6. Which action was taken by the Bolsheviks under the leadership of Vladimir Lenin? *

supporting a traditional economy
eliminating political opposition
surrendering to the Provisional Government
extending the war against Austria-Hungary
Other:

7. Which goals are most closely associated with the Russian Revolution of 1917? *

nationalism, democracy, and livelihood
science, technology, and agriculture
peace, land, and bread
liberty, equality, and fraternity

8. One reason the Bolsheviks gained peasant support during the Russian Revolution was because the Bolsheviks promised to *

abolish communes
redistribute land
bring modern technology to Russian farms
maintain an agricultural price-support program

9. What was a major reason the Russian people engaged in the Revolution of 1905? *

failure to emancipate the serfs
discontent with involvement in World War I
dissatisfaction with czarist rule
irritation over the banning of the Orthodox church

10. Totalitarian governments are characterized by the *

elimination of heavy industry
use of censorship, secret police, and repression
lack of a written constitution
support of the people for parliamentary decisions
Other:

Answers

Answer:

Joe binden won and trump got kicked

Explanation:

approved by the white house

The U-Boat, or "under cover boat" was a type of ship used by many navies in World War 1. Merchant ships were rebuilt with light armour, and hidden or disguised medium guns, allowing them to pretend to be unarmed freighters until their targets was within range, at which point they would drop the disguise and attack with the advantage of surprise.

Answers

The correct answer to this open question is the following.

Unfortunately, you forgot to include a question. Here we just have a series of statements, but not a question.

What is your question? What do you want to know?

If this is a true or false question, the correct answer is false.

It is false that the U-Boat, or "undercover boat" was a type of ship used by many navies in World War 1. Merchant ships were rebuilt with light armor, and hidden or disguised medium guns, allowing them to pretend to be unarmed freighters until their targets were within range, at which point they would drop the disguise and attack with the advantage of surprise.

U-Boats were one of the most advanced technologies developed by the German military during World War 1.  U-boats were designed specifically to be one of the first kinds of submarines used to capture and destroy cargo ships from the allies that were transporting supplies, weapons, and food to the allied troops.

One of those U-boats was the submarine that sank the Lusitania ship.

Check all that were effects of the Black Death in Europe: *
******not the last

Answers

Answer:

The effects of the Black Death were many and varied. Trade suffered for a time, and wars were temporarily abandoned. Many labourers died, which devastated families through lost means of survival and caused personal suffering; landowners who used labourers as tenant farmers were also affected.

Explanation:

Explain the importance of statues in Catholic worship

Answers

Me das mas información?

This is known as intercession. Statues can also help focus a person’s mind on an aspect of prayer or worship. For example, a statue of Jesus on the cross can help us remember the sacrifice he made.

Hope this helps! Please mark brainliest if this is correct!!

The Crusades continued off and on for approximately:

Answers

Between 1095, was when the First Crusade was launched, and 1291, when the Latin Christians were finally expelled from their kingdom in Syria, the Crusades continued for several centuries after 1291.

Individuals who are legally admitted into the United States and have permission to stay and work here are known as
(5 Points)

lawful permanent residents

citizens

illegals

resident visitors

Answers

Answer:

lawful permanent residents

Explanation:

I am one

I think it’s a sorry if I’m wrong

Click to review the online content. Then answer the question(s) below, using complete sentences. Scroll down to view additional questions.
Online Content: Site 1

Describe the physical features of Mount Kilimanjaro. What makes this feature unique. (Site 1)


PLEASE HELPPPPPP ASAP

Answers

Answer:

The majestic mountain is a snow-capped volcano. Located in Tanzania, Mount Kilimanjaro is Africa's tallest mountain at about 5,895 meters (19,340 feet). ... Also called a stratovolcano (a term for a very large volcano made of ash, lava, and rock), Kilimanjaro is made up of three cones: Kibo, Mawenzi, and Shira

Other Questions
Which statement accurately describes static electricity?O A. It is caused by positively and negatively charged particlesgathered together.B. It is caused by positively charged particles that flow.c. It is caused by only negatively charged particles on a surface.D. It is caused by separated positively or negatively chargedparticles. The diagram shows the apparent motion of the Sun across the sky. EAST WEST Sunrise Which action causes the Sun to appear to move in this way? A. Earth rotates from south to north. B. Earth rotates from north to south. C. Earth rotates from west to east. D. Earth rotates from east to west. Can yall help me on a question 15?! I need help please help me !!!!!! Please need help thank PLEASE GEOMETRY HELP WILL MARK BRAINLIEST!!! 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA When Anita planted a large bush in her garden, it was 5 feet tall. Now it is 40% taller. How tall is the bush now? Use stock market in a sentence. (Pls don't make the sentence too long, thx) Need help question #3. Show steps please The work of a student to solve a set of equations is shown: Equation A: y = 4 2z Equation B: 4y = 2 4z Step 1: 4(y) = 4(4 2z) [Equation A is multiplied by 4.] 4y = 2 4z [Equation B] Step 2: 4y = 4 2z [Equation A in Step 1 is simplified.] 4y = 2 4z [Equation B] Step 3: 0 = 6 6z [Equations in Step 2 are added.] Step 4: 6z = 6 Step 5: z = 1 In which step did the student first make an error? (5 points) The rectangle below has an area of 70 square meters.Find the dimensions of the rectangle.(x - 11) (x - 8) Which best defines a cause and effect text structure?Question 1 options:Cause and effect texts demonstrate the similarities and differences between two or more topics.Cause and effect texts outline a process or series of events in a time order from beginning to end.Cause and effect texts explain why things happen in terms of reasons and results.Cause and effect texts outline different steps in a procedure in an ordered sequence. pentru triunghiurile congruente ijk si lmn sau scris cate trei congruente ale elementelor acestora scrie congruentele lipsa Which statement below best describes the idea of "Manifest Destiny"? A: The belief that the nation must stay within its boundaries B: Europe would no longer be able to colonize the Western Hemisphere C: The belief that expansion was for the good of the country and the right of the country D: The United States would respect land claims of Native Americans and all other countries What is the lowest term of 75/60 as an improper fraction? A quadrilateral has the following coordinates:Point A: (4, 7)Point B: (4, 7)Point C: (4, 7)Point D: (4, 7)What is the length of side CD? SATOSAthBSABB can someone please help me to do this? Will mark brainlest to whoever finds the answer for the square units