Which of the following correctly describes the cell cycle?
A: Event in the normal life cycle of a cell

B:Events in the normal life cycle of a human

C:Event that change DNA

Answers

Answer 1

Answer:

A: Event in the normal life cycle of a cell


Related Questions

Speciation means the formation of a new species.


True
False

Answers

Answer:

true

Explanation:

Definition: Speciation is the process by which new species form. It occurs when groups in a species become reproductively isolated and diverge.

Answer:

true because it means the formation of a new plant or animal species

The current genetic code evolved Please choose the correct answer from the following choices, and then select the submit answer button. Answer choices before the common ancestor of all extant life. after the common ancestor of all extant life but before eukaryotes split from the other domains of life. after eukaryotes split from other domains of life but before the split of multicellular animals and multicellular plants. after the split of multicellular animals and multicellular plants but before the common ancestor of chordates. after the common ancestor of chordates.

Answers

Answer:

before the common ancestor of all extant life.

Explanation:

Genetics can be defined as the scientific study of hereditary in living organisms such as humans, animals and plants.

Heredity refers to the transfer of traits (specific characteristics) from the parent of a living organism to her offspring through sexual reproduction or asexual production. Some examples of hereditary traits are dimples, tongue rolling, baldness, handedness, freckles, curly hair, color blindness, height, etc.

Basically, deoxyribonucleic acid (DNA) is an organic complex-molecular structure found in all living organisms. It comprises of genes and is essentially the foundation block of all living organisms such as humans, animals and plants.

The current genetic code evolved before the common ancestor of all extant life i.e that are still in existence or alive.

Explain why it is still an evolutionary advantage to produce flowers in
plants.​

Answers

Answer:

Those specialized flowers are able to attract organisms to help pollinate and distribute seeds. Another cool advantage is the fruit/seed packaging.

I NEED THIS ASAP
Which indicates what happens to the kinetic energy when the mass of a moving object increases?

A. The kinetic energy does not change

B. The kinetic energy increases by the same factor as the mass increase

C. The kinetic energy increases by the square of the same factor as the mass increase

D. The kinetic energy decreases by the same factor as the mass increase

Answers

Answer:

C. The kinetic energy increases by the square of the same factor as the mass increase

Explanation:

As the object moves faster, potential energy goes down and kinetic energy increases.

I generally remain in the nucleus what am I DNA, RNA, or both?

Answers

Answer:

DNA

Explanation:

The cactus has a specialized fleshy stem that is specialized to store water for long periods of time. Which plant tissue most likely makes this action possible?

I know the answer is Ground, but i need to know WHY the answer is ground tissue. I WILL MARK BRAINLIEST

(on EDGE)

Answers

Answer:

If I were to guess its probably Vascular

Explanation:

Cactuses can store water nearly four months mainly in the winter and watering is not required for them frequently during that time. The stem acts as a reservoir for the amount of water it holds. The ground tissue of cactus has lots of parenchymal cells that store water.

What is parenchyma?

The ground tissue system comes from a ground meristem which has three tissues, namely parenchyma, collenchyma, and sclerenchyma.

The ground tissue of cactus has many parenchyma cells that store water.

Thus, it can be concluded that the ground tissues helps cactus to store water for a long time.

For more details regarding ground tissue, visit:

https://brainly.com/question/346979

#SPJ2

Please help, I’ll give brainliest :)

Answers

Answer:

a,b and c

Explanation:

( it might be wrong pls dont report me just let me kno y its wrong )

Help!!! please!! this test is timed!! I will give brainliest!!!
What is a system?
2 points
The solid rock part of Earth, including mountains, valleys, continents, and all of the rock beneath the oceans
The set of all water on the earth's surface, such as lakes, seas, and oceans
A group of related parts that all work together to perform a specific function
The greenhouse gases that help keep the earth at a temperature where water is in liquid form

Answers

Answer:

A group of related parts that all work together to perform a specific function

Explanation:

A. Producer
B. Primary consumer
C. Secondary consumer
D. Tertiary consumer

Answers

Answer:B. Primary consumer

Explanation:The reason why Its b because that primary comsumers are mostly herbivores or the primary comsumer is the first consumer to eat the producer.Hope it helps!

Identify one food chain in this ecosystem.

Answers

Answer:

Sun -> Grass -> Beetle -> Blue Jay

Sun, Grass, Worms, Woodpecker

A bee gets nectar from a flower and the flower gets help with pollination. Both benefit, so the symbiotic relationship is _______________.
Competition

Commensalism

Mutualism

Parasitism

Answers

the answer is Mutualism

When a squirrel hears a strange noise that might indicate the presence of a predator, fight-or-flight hormones are released into its system. The hormones help prepare the squirrel's body to do strenuous physical activities, like quickly climbing up a tree, more efficiently. Which statement describes how two organ systems work together to help a squirrel respond to a possible external threat?

Answers

Answer:

The flight-or-flight hormones are released by the endocrine system in response to environmental changes detected by the nervous system.

Explanation:

yes

What is an antibiotic? Which class of antibiotics works best for Bordetella pertussis?

Answers

You can download answer here

tinyurl.com/wpazsebu

_____ is a group of similar organism that can mate with each other and can make fertile offsprings

Answers

Answer:

A species is a group of similar organisms that can breed with one another to produce fertile offspring.

Explanation:

For example, humans are one species and dogs are another species. Individuals of the same species can reproduce to make more individuals of the same species.

Answer:

A species

Explanation:

Seventy percent of the plants containing chemicals useful for cancer treatment are found only in rain forests. What type of ecosystem service do these plants provide ?

Answers

Answer: The type of ecosystem service these plants provide is PROVISIONING SERVICES.

Explanation:

Ecosystem services is defined as the activities that occurs in an ecosystem which directly or indirectly enhance the well being of humans. They are grouped into four different categories which include:

--> Regulating services

--> cultural services

--> supporting services and

--> provisioning services

The PROVISIONING SERVICES obtained from the ecosystem are any benefits or products that can be gotten from nature. These include:

--> food

--> drinking water

--> wood fuel

--> natural gas

--> medicinal resources (gotten from herbal plants which can be used to manufacture drugs for cancer treatments).

Please complete the following DNA strands

1. AGGTCCAAGCTCAAATTTCCCC

2. GAAACCCCTTAAACCTTAATTCC

3. GCGCGCGCAAATTTTTCCCATCT

Please complete the following strands using RNA:

1. AGGTCCCAAAGGCCCTTTCC

2. UAAAGGGCCCAGCCCACC

3. CUAAAAGGGGGUUUUAACC

Answers

1) TCCAGGTTCGAGTTTAAAGGGG
2) CTTTGGGGAATTTGGAATTAAGG
3) CGCGCGCGTTTAAAAAGGGTAGT

1) TCCUGGGTTTCCGGGUUUGG
2) AUUUCCCGGGUCGGGUGG
3) GAUUUUCCCCCAAAAUUGG
(Pretty sure)

What factors do you need to know in order to calculate a region's population growth

Answers

The amount of people having baby’s or the amount of people dying

Could somebody please help me?



Select the correct answer

How many pathways are depicted in the image of the carbon cycle?

A) one
B) two
C) three
D) four


Thank you! :)

Answers

Answer:

4

Explanation:

Answer:

4

Explanation:

Plato user

ASAP due today
Explain one challenge we face using nuclear energy.

Answers

Answer:

The major challenges facing the nuclear industry include ensuring power plant safety, protecting reactors from natural disasters and external aggression, and finding effective solutions for long-term waste management.

Explanation:

Answer:

The major challenges facing the nuclear industry include ensuring power plant safety, protecting reactors from natural disasters and external aggression, and finding effective solutions for long-term waste management.

Have a nice day!

Which option describes the function of RNA polymerase?
Select one:

Carrying amino acids to the transcription site.

Moving mRNA strands into and out of the nucleus.

Splitting the DNA double strand into two single strands.

Forming an RNA strand using a DNA strand as a template.

Answers

Answer:

brown

Explanation:

have you pooped today?

The option which describes the function of RNA polymerase is that it forms an RNA strand using a DNA strand as a template. Thus, the correct option for this question is D.

What is RNA polymerase?

RNA polymerase may be defined as a multi-unit enzyme that synthesizes RNA molecules from a template of DNA through a process called transcription. This enzyme is responsible for copying a DNA sequence into an RNA sequence, during the process of transcription.

RNA polymerase binds to DNA, separates the strands, then uses one of the strands as a template from which to assemble nucleotides into a complementary RNA strand.

It uses a single-stranded DNA template to synthesize a complementary strand of RNA. Specifically, RNA polymerase builds an RNA strand in the 5' to 3' direction, adding each new nucleotide to the 3' end of the strand.

Therefore, the option which describes the function of RNA polymerase is that it forms an RNA strand using a DNA strand as a template. Thus, the correct option for this question is D.

To learn more about RNA polymerase, refer to the link:

https://brainly.com/question/15872478

#SPJ2

Of the phenomena that correlate with the data above, the one that is the most direct consequence of the trend in air travel is the increase in the spread of infectious diseases the increase in the spread of infectious diseases A the increase in urban sprawl the increase in urban sprawl B the decrease in biodiversity the decrease in biodiversity C the increase in hypoxic aquatic ecosystems the increase in hypoxic aquatic ecosystems D the decrease in the total fertility rate of developed nations

Answers

Answer: the increase in the spread of infections diseases

Explanation:

got it right

The increase in the spread of infectious diseases are the most direct consequence of the trend in air travel. So, the correct option is A.

What are Infectious diseases?

Infectious diseases are defined as disorders that are caused by organisms such as bacteria, viruses, fungi or parasites. Many organisms live in and on our bodies which are generally harmless or even helpful but some organisms can cause disease. Some infectious diseases can spread from person to person.

Infectious diseases can be viral, bacterial, parasitic or fungal infections a rare group of infectious diseases known as transmissible spongiform encephalopathy (TSE). The increase in the spread of infectious diseases are the most direct consequence of the trend in air travel.

Therefore, the correct option is A.

Learn more about Infectious diseases, here:

https://brainly.com/question/11478894

#SPJ6

Your question is incomplete, most probably the complete question is:

Of the phenomena that correlate with the data above, the one that is the most direct consequence of the trend in air travel?

A. the increase in the spread of infectious diseases

B. The increase in urban sprawl

C. the decrease in biodiversity  

D. the increase in hypoxic aquatic ecosystems  

E. the decrease in the total fertility rate of developed nations

Alex wants to know if a fossil he found was closely related to cats. some likely features of the fossil that can help him reach a conclus Check all that are true.

A. Bone Structure

B. Blood

C. Tissue

D. Skull Shape​

Answers

Answer:

A and D

Explanation:

A fossil is made of bones and it's the dead version of the animal, therefore it has to be A and D as blood and tissue have already rotted away.

I hope this helps you!! ^-^

Need the answer quick pls thanks

Answers

Nitrogen Bases (A,C,G and T)

How does carbon dioxide and
water enter the plant?

Answers

Answer:

CO2 through the leafs and H2O through the roots

Explanation:

CO2 enters through the stomata and the water gets into the plant through the roots and goes up the plant through capillary action.

Answer:

co² enters the plant by stomata where as the water enters through roots when we watered the plant

⚠️HELP⚠️

UV rays, chemicals, radiation, and tobacco products are all agents known to cause cancer because they can cause the DNA in cells to be incorrectly transcribed, therefore continuously making a
protein. What are these agents caffed?
Pollution
A
B
Mutagens
С
Polypeptides
D
Anticodons

Answers

Mutagens like chemicals and UV radiations damages DNA replication

1)What does the term Science means to you as a student?​

Answers

Answer: 1 : knowledge about the natural world that is based on facts learned through experiments and observation. 2 : an area of study that deals with the natural world (as biology or physics)

Explanation:

Answer:

Death and Boredom

Explanation:

Approximately time passes between B and F

Answers

Answer:

14 days

Explanation:

It takes 27 days for the moon to make a full rotation around the earth. Because half the of the rotation around the earth has been made, half 27. Half of 27 is 13.5, so the time between B and F is approximately 14 days.

an energy-producing organelle found in nearly all cells of plants and animals.

Answers

Answer:

Mitochondria

Explanation:

Mitochondria is and energy kinda like a battery and cells have thousands of mitochondria. Hope this helps :)

Based on the information given in the chart, which kingdom most likely has the highest percentage of photosynthesizing organisms? A. Eubacteria B. Animalia C. Plantae D. Fungi

Answers

Answer:

The answer is C. in other form Kingdom Plantae its C

A chewing insect damages the vascular tissue of a plant system. This damage will most directly affect the

Answers

Answer:

Conduction of water and minerals between the roots and leaves

Explanation:

- EIjiro

Other Questions
How has US-Cuba immigration policy changed as of January 2017?O A. The US government will not accept any Cuban immigrants.B. Cubans can no longer immigrate to the United States without a visa.C. The United States no longer allows its citizens to immigrate to Cuba.OD. Cuba no longer allows its citizens to immigrate to the United States.Ok ASAP. According to the text, why are justices selected for life?a. Justices are selected for life so they can make decisions without worrying about being fired.b. Justices are selected for life so they can learn more over time about the U.S. Constitution. c. Justices are selected for life so they can serve as part of the judicial branch of the government.d. Justices are selected for life so they can have extraordinary experiences. Which invertebrate from the picture did you choose from Figure 1? HINT: There is only 1 on there to choose.Explain how body plan and anatomy enables your chosen invertebrate to perform the essential functions it needs to survive. What is the message of this cartoon? A. The Arab Spring revolts led to lower gas prices in America B. Although America enjoys political freedom, its economy depends on foreign C.Middle Eastern countries need help forming democratic governments D.There are no natural resources in the Middle East of any value Skylar has sphere-shaped toys for her pool that each have a radius of 2 inches. If the toys fill with water, how many cubic inches of water would it take to fill all 12 toys? RomeWhat was the main appeal of Christianity to the common people? |List two ways that Civil Wars hurt a country.Rome had to rely on mercenaries. Why is that a problem?The Roman Empire split. Which city was the capital of the Western half? C)(2ab) +3(ab)-x(-3ab) Someone pls help im new to this so tysm if you do help:D What is one way that authors use setting to help further a story?by using it to introduce new characters and develop main charactersby only including one setting and describing it in great detailby using the setting to indicate an important theme of the storyby making the setting unimportant so readers can focus on the plot Which of the following MOST influenced scientists to conclude that the fossils found in the Philippines were from a new humanspecies?(A)the tools that were found near the fossils(B)the unique shape and size of the fossils(C)the location where the fossils were discovered(D)the age of the fossils that were tested The balance of Micah's checking account is $648. Micah needs at least $800 in the account to cover his expenses. Write and solve an inequality that tells how much money Micah needs to deposit. Explain why there are infinite solutions to the inequality. PlZZ answer asap Suppose that an earthquake has just occurred as pictured below the first P wave is shown as the large circle and the first S wave is shown as a smaller circle what would the seismogram And recording station a display at the moment the image below was taken What are the opposites of 9, 2.7, 3.35, and 6 15 ? Enter the answers in respective order, each separated by a comma. The advantages and disadvantages of the public budget a) 3 -2.(x + 3) = -18 Data Set: 5, 8, 10, 10, 15, 18, 23. What is the upper quartile limit (Q3) of this data set? * Is water an element or compound Please help!!!!Order these numbers from least to greatest.6.1, 6.22, 6.202, 6.1021 9. Who benefits from herd immunity? Complete the following sentence. An animals genetic and observable traits are called the _and_dont have options