Which of the following do sage grouse and California tiger salamanders have in common?
They both thrive on ranchlands used for grazing.
They both consume vegetation that cattle cannot eat.
They both play a critical role in balancing the ecosystem of ranchlands.
They both establish mutualistic relationships with grazing herd animals.

Answers

Answer 1

Answer:

The answer is "They both play a critical role in balancing the ecosystem of ranchlands"

Explanation:

The more prominent sage-grouse, otherwise called the sagehen, is the biggest grouse (a kind of bird) in North America. Its reach is sagebrush nation in the western US and southern Alberta and Saskatchewan, Canada. It was known as essentially the savvy grouse until the Gunnison sage-grouse was perceived as a different animal groups in 2000. The Mono Basin populace of sage grouse may likewise be unmistakable.

The more noteworthy sage-grouse is a lasting occupant in its favorable places however may move short distances to bring down heights during winter.

Answer 2

Answer:

They both thrive on ranchlands used for grazing.

Explanation:

TRUST ED2022


Related Questions

Why do most of the marine species live at or near the surface of the ocean

Answers

Answer:

Most marine organisms live within the sunlit surface waters. Strong sunlight supports photosynthesis by marine algae. Algae either directly or indirectly provide food for the majority of organisms. ... Most marine animals also live near the surface because this is where they can find food.

Explanation:

Brainliest please?

Please help. What safeguards are in place to protect Americans from unsafe food? Are these methods science-based?

Answers

Answer: The FDA and USDA cerate food safety programs, safeguards to protect Americans, to protect people from unsafe food. The FDA has monitoring programs for pathogens, naturaltoxins, pesticides, etc.; their methods are science-based.

The safeguards that are placed to protect Americans from unsafe food are FDA and USDA. FDA means food and drug administrator and USDA means U.S. department of agriculture.

What are FDA and USDA?

FDA stands for food and drug administrator. It is a health and food department to ensure public health and to check the food items that the citizens are consuming.

USDA stands for The United States Department of Agriculture. The department is responsible for making the laws regarding food quality, and they also develop new qualities of fruits and vegetables.

These departments are based on scientific research and methods. Many scientists work under this to save people from having bad food.

Thus, The FDA and USDA are the safeguards set up to protect Americans from tainted food.

To learn more about FDA and USDA, refer to the below link:

https://brainly.com/question/21469257

#SPJ2

explain respiration cellular level​

Answers

Answer:

first off not to be rude but its cellular and second,

Explanation:

Cellular respiration is a set of metabolic reactions and processes that take place in the cells of organisms to convert chemical energy from oxygen molecules or nutrients into adenosine triphosphate (ATP), and then release waste products.

I need help asp due in about an hour. List three kinds of information that can be learned by sequencing DNA. Also list three specific things that have been learned from the sequence of the human genome.

Answers

Answer:

These bases provide the underlying genetic basis (the genotype) for telling a cell what to do, where to go and what kind of cell to become (the phenotype).

Whole genome sequencing is a lot like weather forecasting. It doesn't predict exactly what will happen, but gives you the chances of something happening. This means that it will tell you more about your risk for a certain disease, like diabetes, not if you have diabetes or not.

Answer:

1. any genetic information can be found through sequencing such as, eye colour, hair colour, and skin colour

2.

Improved genetic testing to gauge predisposition for disease

Tracing genes to diseases and birth defects

Creating customized therapies based on genetic profiles

Manipulating or repairing DNA to stave off disease

Explanation:

Earth's crustal bedrock at the Mid-Atlantic Ridge is.
composed mostly of
1. Basalt with a density of 2.7 g/cm3

2. basalt, with a density of 3.0 g/cm

3. granite, with a density of 2.7 g/cm3

4.granite, with a density of 3.0 g/cm

Answers

Answer: basalt, with a density of 3.0 g/cm^3

Explanation:

Earth's crystal bedrock on the Mid-Atlantic Ridge consists typically of basalt, with a density of 2.7 g/cm3.

What is Mid-Atlantic Ridge?

A petrographic have a look at of rocks dredged from the Mid-Atlantic Ridge via way of means of the studies vessel, Atlantis, in 1947 and 1948 suggests that olivine basalt and basalt are the maximum not unusualplace rock kinds of the Mid-Atlantic Ridge.

If magma cools quickly, as an example whilst basalt lava erupts from a volcano, then many crystals shape very quickly, and the ensuing rock is fine-grained, with crystals commonly much less than 1mm in size.

Read more about the bedrock refer link :

https://brainly.com/question/26460927

#SPJ2

what is Acetyl-coA and how does it help with food digestion ?

Answers

Answer: what is Acetyl CoA is made from pyruvate under aerobic conditions in the mitochondria. The process of conversion is irreversible. I don't know the other half I'm sorry.

Explanation:

Acetyl CoA Used by the citric acid cycle as a fuel. Carbon acetyl groups are converted to CO2 and ATP and electrons (carried by NADH and FADH2) create even MORE electrons.  Acetyl CoA is made from pyruvate under aerobic conditions in the mitochondria. The Process of conversion is irreversible.

the chemical reaction in which glucose is converted to ATP in the mitochondria ​

Answers

Answer:

Glycolysis

Explanation:

Glycolysis. Six-carbon glucose is converted into two pyruvates (three carbons each). ATP and NADH are made. These reactions take place in the cytosol.

cellular respiration allows organisms to release

Answers

Answer:

energy // ATP

Explanation:

Which of the following pairs of organisms belong to the same population?
A. a dog and a cat
B. a marigold and a geranium
C. a human mother and her child
D. a spider and a cockroach

Answers

B. would be the answer.

I hope this helps

A pair of human mother and her child belongs to the same population.

What is population?"Individuals of any species live in groups in a well defined geographical area, share or complete for similar resources, potentially interbreed and thus constitute a population."

A dog and a cat, a marigold and a geranium and a spider and a cockroach do not share similar resources and they don't interbreed so they do not belong to the same population.

Hence, the correct option is C. a human mother and her child.

To know more about population here

https://brainly.com/question/16138725

#SPJ2

Explain the interaction with another body system.

Answers

Answer:

Body systems are used throughout your body to help you move and to live like the heart for example.

A student helps his teacher lift a 200 N box of books 1.2 m from the floor to the desktop. In which of the following situations will he do more work? (DOK 3, AKS
8d)
Ο Α.
He lifts a 175 N box to the same height
OB.
He lifts a box of the same weight to a height of 1.7 m.
С.
He lifts a box of the same weight to a height of 0.9 m.
D.
He lifts a 98 N box to the same height

Answers

Answer:

Since he is lifting more N its A 175N

A solution with a lower solute concentration in comparison to Solution

Answers

Answer:

Hypotonic

Explanation:

When you are comparing solutions with unequal solute concentrations, the solution with a higher solute concentration is a hypertonic, while the one with a lower one is a hypotonic. If they are equal, then they are isotonic.

Activity #1
Normal DNA Sequence
DNA:
TACCCCGTGCAT ATAT CATATAGCACT
mRNA:
Protein:
Mutated DNA Sequence
DNA:
TACCCCGTGCACATATCGTATAGCACT
mRNA:
Protein:
Describe the effects of the change(s) in the mutated DNA sequence. Did the protein change? Do you think
this protein can perform its normal function?
Stephanie Elkowitz
Help please!!!!

Answers

for the normal DNA sequence, since thymine (T) binds with adenine(A) and Adenine(A) binds with uracil(U) because there is no thymine is RNA guanine(G) pairs with cytosine(C) :

normal DNA:TACCCCGTGCAT ATAT CATATAGCACT

normal mRNA:AUG GGG CAC GUA UAU AGU- AUA UCG UGA

i grouped letters in threes as codons

normal Protein:methionine-glycine-histidine-valine-Tyrosine-Serine-Isoleucine-serine-stop

 mutated DNA:TACCCCGTGCACATATCGTATAGCACT

mutated mRNA:AUG GGG CAC GUG UAU AGC AUA UCG UGA

mutated protein:methionine-glycine-histidine-leucine-Tyrosine-Serine-Isoleucine-Serine-stop

In the mutated protein valine is replaced with leucine. Those two amino acids have different radicals that perform different functions so the protein will have an altered function.

The largest diversity of plants and animals on the planet is found in one terrestrial biome.

Answers

Answer:

There are diversity of plants and animals species found on the terrestrial biome. The biome such as forest, desert are rich in variety of plants and animals. This states that largest diversity is found in almost all the types of terrestrial biome.

Explanation:

ILL GIVE BRAINLIEST PLZ HELP.
Atoms of carbon-14 are radioactive. They decay into atoms of the element nitrogen. Suppose that a sample of rock is taken from a fossil. The sample has 500 atoms of carbon-14 and 1500 atoms of nitrogen. If carbon-14 has a half-life of 5700 years, how old is the fossil? 5700 years old 11,400 years old 17,100 years old 2850 years old

Answers

Answer:

11,400 years old

Explanation:

The total  number of atoms present at the beginning = number of C-14 + number of N-14 atoms.

Hence;

1500 + 500 = 2000 atoms = No

At time t, N = 500 atoms of C-14 remains

Since the half life of C-14 (t1/2) = 5700 years

N/No = (1/2)^t/t1/2

500/2000 =  (1/2)^t/5700

1/4 = (1/2)^t/5700

(1/2)^2 =(1/2)^t/5700

2 = t/5700

t = 2 * 5700

t = 11,400 years old

A scientist wants to determine whether a certain type of yeast is able to perform anaerobic respiration. Describe a test the scientist could perform to see if the organism is capable of this.

Answers

Answer:

Follow these steps if you are unsure of the freshness of your yeast (or just want to give it a ‘good start’). See a How-to video of this test. Using a one-cup liquid measuring cup, dissolve 1 teaspoon of granulated sugar in 1/2 cup warm tap water at 110°F-115°F. Using a thermometer is the most accurate way to determine the correct liquid ...

Explanation:

Answer:

He could lock the plant in a room with no oxygen at all, if it survives it's anaerobic, if it doesn't then it's aerobic.

Explanation:

An anaerobic organism or anaerobe is any organism that does not require oxygen for growth. It may react negatively or even die if free oxygen is present.  


In 1859, when Darwin published "On the Origin of Species by Natural Selection", which argument was he explaining?
A) An explanation for the change in types of minerals in an area through ecological
succession.
B) The reasons for the loss of biodiversity on all habitats on Earth.
C) An attempt to explain the structural similarities observed among diverse living
organisms.
D) The effect of carrying capacity on the size of population.

Answers

i believe the answer is C

As a person ages, the body takes a downward decline to a point where functioning is compromised. Identify and discuss two conditions related to aging that result from decline. The conditions may come from any of the organ systems. What can be done to delay or reduce the onset of decline.

Answers

Answer:

Your body may heal more slowly. There are fewer immune cells in the body to bring about healing. The immune system's ability to detect and correct cell defects also declines. This can result in an increased risk of cancer

Explanation:

Your body may heal more slowly. There are fewer immune cells in the body to bring about healing. The immune system's ability to detect and correct cell defects also declines. This can result in an increased risk of cancer

pls help lol jakakaka​

Answers

Answer:

IS C!!!

Explanation:

I JUST DID THAT IN SCIENCE LOL

the awsner is c, i had taken this test already.

which of the following best describes Mendel's idea of segregation?
A. Male offspring receive traits only from the male parent.
B. Female offspring receive only form the male parent.
C. Each parent has two copies of each gene and passes on only one copy to its offspring.
D. Each parent has one copy of each gene. each offspring receives half of its genes from each parent.

Answers

Answer:

C

Explanation:

Since we know about mitosis and sexual reproduction, each parent passes on only one copy of the gene because they got a copy of a gene from each of their parent before, and the new child will end up with two genes, one from each parent.

Write a paragraph about the symbiotic association between algae and fungi​

Answers

Answer:

if you need the answer then follow

Explanation:

me and I swear I will send the answer after you follow me

A biological molecule is analyzed and it is discovered that the molecule is composed of several amino acids. Which of these identifies the biological molecule?
A. It is a monosaccharides
But is an unsaturated fat
C. It is a protein
D. It is a lipid

Answers

C. Protein is correct

What is the manipulated variable in this experiment?
O A. The distance the snails moved
OB. The size of the petri dishes
C. The temperature of the water
D. The number of snails observed HELP ME

Answers

The correct answer is C. The temperature of the water

Explanation:

In an experiment such as the one described about the speed of snails in water, the manipulated variable is the factor or element that is manipulated on purpose. This means the researcher or researchers slightly change this element to compare how this affects another variable. In this context, the manipulated variable is the temperature of the water because researchers used three different temperatures (cool, room-temperature, and warm), and therefore they manipulated or changed this factor. Moreover, it is expected temperature affects the distance nails move, which is the main variable.

Which of the following is an example of technology we currently add to people's bodies? O A Computer brain OB Electronic lungs OC Internal heaters D. Prosthetic leg​

Answers

Answer:D. Prothetic leg

Explanation:

All the other answer choices are still dreamt of by many scientists and engineers. but you always see people wearing prosthetic legs. D is the obvious answer.

How would your life change if I stopped using plastic? Use your brain and imagine.

Answers

If we stopped using plastic we would have to use glass plates, bowls, silverware and cups.

Any one know what structure this is

Answers

That is an ATP molecule if I remember correctly

Answer:Pretty sure its D

Explanation:

PLEASE HURRY,(GIVING BRAINLIEST) (THE ACTUAL SUBJECT IS SCIENCE)After a major forest fire kills all of the plants in an area, the first plants to grow in the burned area are often types of grass. Because they are the first thing to grow in the new ecosystem, these types of grass are called pioneer species. What adaptations would help the grass be a successful pioneer species?

A.

slow reproduction and the ability to grow in sunny places

B.

rapid reproduction and the ability to grow in sunny places

C.

slow reproduction and the ability to grow in shady places

D.

rapid reproduction and the ability to grow in shady places

Answers

Answer: B

Explanation:

To help the pioneer species to grow, it needs to have rapid reproduction. But, it also needs the sun to grow very well. If it does not have the Sun, it will most certainly die and be endangered in the area. The answer is B, we need both rapid reproduction and the Sun.

Answer:

rapid reproduction and the ability to grow in sunny places

Explanation:

After a major fire, less sunlight is blocked by trees and other plants. Plants that can use the increased sunlight are more likely to thrive in the new environment. Rapid reproduction would help a plant species to spread more quickly to take advantage of the resources and lack of competition. Therefore, the adaptations that would help grass be a successful pioneer species are rapid reproduction and the ability to grow in sunny places.

Refer to the diagram ( Figure 2) provided below . Which process is taking place? Sc. 912. L.16.15

Answers

Answer:

Meiosis

Explanation:

Took the test

Cell walls in plants provide_______
1) Water storage
2) Control of cell function
3) Structural support

Answers

Answer:

3.

Explanation:

Plant cell walls primarily provide mechanical support for cells and collectively form the skeleton of the plant.

Answer:

the answer is choice 3

Explanation:

hoped I helped

An experiment is designed to compare the effects of glucose and sucrose on the osmoticpotential of a model cell. Two dialysis bags are used, one filled with a solution of 5% by massglucose and the other with a 5% by mass sucrose solution. A given membrane is permeable towater but impermeable to glucose and sucrose. Each membrane bag is then placed in a beaker ofdistilled water for two hours. The change in mass of the glucose bag is recorded below.Solution (5% by mass) Initial Mass ofSolution andMembrane Bag (g) Final Mass of Solutionand Membrane Bag(g)Glucose in DistilledWater 10.0 13.2Sucrose in DistilledWater 10.0 ?I got this question incorrect because I said the glucose would pass through the semipermeablemembrane, however, it would be the water that passes through. One way I can prevent myself.

Answers

Answer:

i dont understand you're qiestion

Glucose can pass through the semi permeable membranes where the molecules can pass because they are soluble in water enough. The  molecules can pass through because of the solubility factors.

What is a semi permeable membrane ?

It is the semi permeable membrane where the half of the molecules get passed through the membrane. The molecules are selectively present.

Cell membranes are an example of semi-permeable membranes. Cell membranes allow small molecules such as oxygen, water carbon dioxide and glucose to pass through, but do not allow larger molecules like sucrose, proteins and starch to enter the cell directly.

Transport is helped by certain molecules as well where the few of the ions, channels and the molecules are taken up by the membrane through the selected transportation of the ions.

Learn more about selectively permeable membrane at :

https://brainly.com/question/11635962

#SPJ5

Other Questions
How does blood change as it passes through a kidney? Identify and define an enduring issue.Argue why the issue is significant and how it endured across time. We only see objects because they absorb light. True or False? How did WWI change opinions about womens suffrage? 50 students live in a dormitory. The parking lot has the capacity for 30 cars. Each student has a car with probability 12 , independently from other students. Use the CLT (with continuity correction) to find the probability that there won't be enough parking spaces for all the cars. answer the following: describe the poem being brave at night? Write an equation of the line with a slope of 3 and a y-intercept of -7. uncontrolled cell division can lead to the formation of masses of cells that can remain in place called ____ tumors or ones that can move called ___ tumors Why is walking a popular way to exercise and socialize? On Monday, Cody bought 414141 cherries. On Tuesday, Cody ate 191919 cherries. Now, she wants to divide the remaining cherries into bags of 444 cherries each.Estimate how many bags of 444 cherries Cody can make.Choose 1 answer: Which line from the passage supports the idea that the Greeks believed that gods were responsible for the weather? 1. "At dawn, Circe sent a favourable wind to take them on their way." 2. "They must all know what to do when danger strikes." 3. "They use their divine song to attract sailors to come too close." 4. "Then their ships are smashed against the rocks." Which is true about a tornado?A. It can be as dangerous as a hurricane, but affects a smaller area.B. Its winds typically reach 300 miles per hour.C. Its centre is full of sleet and ice.D. It develops over tropical waters of the Atlantic Ocean. Need help ASAP ! Please PLEASE HELP IF UR GOOD AT MATH!!! after allowing 30% discount on the marked price of an article,there is a profit of 10% . if the cost price is 1500 find the marked price Two ships leave the port at 12 noon. Ship A is traveling at the bearing of 146 at 20 miles per hour, and ship B travels at a bearing of N32 E at 28 miles per hour. Approximate how far apart ships are at 3 PM. At what bearing ship A is from ship B at 3 PM. what are the effects of watching TV? The answer, please!!!!!!!! A business bought 500 lamps for $10,000. They want to mark them up 25%. What is the retail price of each lamp? Select the correct text in the passage.Donny has written a letter to his principal. One sentence is unclear because its not specific enough. Which sentence is it?Dear Principal Shelton,We heard that you were looking for a celebrity to come and speak to our school. You dont want to choose just any celebrity; you need to choose someone who can impact our school for good. Emma Watson played the character of Hermione in the Harry Potter movies. Shes someone that students at our school can relate to, admire, and be inspired by.Ms. Watson is known as a kind person, and because of this, she was chosen for an important role in an organization. She believes in the importance of educating girls around the world. She spent time in Bangladesh and Zambia in order to promote education for girls in these two countries. Both of these countries have large populations of women who cannot read. Emma Watson travels the world to encourage people to support equality for females, the empowerment of women, and education for everyone. Not only does her message encourage girls to strive for excellence and equality, but it can also teach everyone the importance of education.