which of the following equations is quadratic?
A. x( x² + 1) = 0
B. 5(4x + 2) = 3
C. (x + 3)(x + 4) = 5

Answers

Answer 1
its (x+3)(x+4)=5 , the third one

Related Questions

Quadrilateral ABCD is inscribed in a circle. Find the measure of each of the angles of the quadrilateral. Show your work.
-
Can you please help solve for x?
x+6+x-2=180

Answers

Answer:

x=88

Explanation:

x+6+x-2=180

2x+4=180

2x=180-4

2x=176

*divivd both sides*

x=88

Answer:

x = 88

A = 94°

B = 102°

C = 86°

D  = 78°

Step-by-step explanation:

We find the angle measurements by finding x first.

what we first do in this equation x+6+x-2=180 is combine like terms

this would equal

2x+4=180

we want x by itself so we subtract 4 from both sides

this would equal

2x=176

x is still not by itself so now we divide 2 by both sides

this would equal

x = 88

Now we just plug in our answers in to the angles meaning

we replace everything that is x in the quadrilateral with 88

Now that we found all the sides with equations there is still one angle that is undefined

We figure this out by subtracting all the angles with 360.

this is because all the angles degrees added in a quadrilateral equals 360. so 360-258=102

so the angle measurement of angle B is 102

Please help guys I’m rlly confused on this question

Answers

Answer:

[tex]762^{8}[/tex]

Step-by-step explanation:

Using the rule of exponents

[tex]a^{m}[/tex] × [tex]a^{n}[/tex] ⇔ [tex]a^{(m+n)}[/tex] , then

[tex]762^{4}[/tex] × [tex]762^{4}[/tex]

= [tex]762^{(4+4)}[/tex]

= [tex]762^{8}[/tex]

I hope everyone who sees this has a wonderful day :)

Answers

*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆**☆*――*☆*――*☆*――*☆

Answer: That is a common saying used in the USA as well as many other places. People enjoy when people say this because it helps them feel good and be grateful!

Explanation:

I hope this helped!

<!> Brainliest is appreciated! <!>

- Zack Slocum

*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆**☆*――*☆*――*☆*――*☆

which pair of functions are inverse of eachother ?

Answers

Answer: a

Step-by-step explanation:

what are the mean and medium to introduce peolpe​

Answers

Wym by that ask in a different way

PLEASE HELP SOMEONE I WILL GIVE YOU BRAINLIEST!!!!

Answers

Answer:

help with what exactly

Step-by-step explanation:

Answer:

What’s the question tho?

Step-by-step explanation:

Four less than five times a number is 11. Find the number.

Answers

Answer:

The number is 3.

Step-by-step explanation:

5x - 4 = 11

5x = 15

x = 3

Solve for x
I need help fast

Answers

Answer:

4x-1=1/2(10x-20)

8x-2=10x-20

-2x=-18

X=9

4) Ari can swim 2 laps per minute. Which equation represents the number of laps,
n, that Ari travels in m minutes?
a n = 2m
b. m = 2n
c. n = 2 +m
d. n = 2 divided by m

Answers

It’s a, n=2m. ||||||||||||||||||||

the difference between a number and 21

Answers

what? i’m confused ayo

Answer:

n - 21

Step-by-step explanation:

"difference" implies subtraction here.  

The difference between a number and 21 is n - 21.

Can u guys please answer this question. This is extremely urgent

The cross-sections of the solids are sectors. Find the surface area, rounding your answer to 1 decimal place.

Answers

Answer:

The total surface area of the figure is approximately 10.2 m²

Step-by-step explanation:

The dimensions of the solid are;

The shape of the solid = An half cylinder

The diameter of the cylinder, D = 1.6 m

The length of the cylinder, l = 2 m

The surface area of the curved part of the solid = π × D × l ÷ 2

Therefore;

The surface area of the curved part of the solid = π × (1.6 m) × 2 m/2 ≈ 5.03 m²

The area of the curved surface, V = 5.03 m²

The area of the rectangular top, A = 1.6 m × 2 m = 3.2 m²

The area surface of the semi-circular sides of the figure = 2 × π·D²/4 ÷ 2

Therefore;

The area surface of the semi-circular sides of the figure = 2 ×π × (1.6 m)²/4 ÷ 2 ≈ 2.01 m²

The total surface area of the figure, A = 5.03 m² + 3.2 m² + 2.01 m² = 10.24 m²

The total surface area of the figure ≈ 10.2 m² (rounding to 1 decimal place)

x/7=1/4
please help will give brainlest

Answers

Answer:

x=7/4

Step-by-step explanation:

cross multiply and divide both sides

4/7 is multiplied by a fraction less than one. Complete the explanation to show how the product compares to the factors.

Answers

Answer:

That is true!

Step-by-step explanation:

What is the measure of angle a

Answers

Answer:

77.79 degrees

Step-by-step explanation:

https://www.omnicalculator.com/math/triangle-angle

this is what I used to get it

The results of a survey are shown. In the survey, 28 students said their favorite dessert is ice cream. How many students were surveyed? Ice Cream: 35% Pie: 15% Candy: 23% Cake: 27%

Answers

Answer:

80 students

Step-by-step explanation:

35% = 28 students (Ice cream)

1% = 28 ÷ 35

= 0.8

Therefore,

100% = 0.8 × 100

= 80 students

Answer:

80 student

Step-by-step explanation:

28÷35×100 = 80

Milan is riding on a bike course that is 60 mlles long. So far, he has ridden 24 miles of the course. What percentage of the course has Milan ridden so far?​

Answers

Answer:

your answer to the question is 40%

If 2x – 7y = 10 is a true equation, what would be the value of 2 + 2x – 7y?

Answers

Answer:

I believe that would be 12 because

Step-by-step explanation:

if 2x - 7y = 10

then if you were to add two to that it would be 12

Which set of ordered pairs demonstrates a function?
A
(-2,-4), (-1, -2), (1, 2), (2, 4)
B
(-2, 4), (1, 2), (1, -2), (2.-4)
C
(-2,4), (-1, 2). (-1, 2), (-2,-4)
D
(-2, 4). (-1, 2), (-1, -2), (-2,-4)

Answers

I think it’s A because the x is in order from -1,-2, 1, 2

The set of ordered pairs from listed options demonstrating a function is given by: Option A: (-2,-4), (-1, -2), (1, 2), (2, 4)

Firstly, we need the definition a function; based on which we can distinguish the correct set of ordered pairs.

What is a function?

If we have two sets A and B as:

[tex]A = \{a_1, a_2, ... \}\\B = \{b_1, b_2, ... \}[/tex]

Then, function [tex]f: A \rightarrow B[/tex] is a connection of elements of A to B such that one element of A is connected to only single element of B, and not many.

The connected pairs are then written as:

[tex]\{(a_i_1,b_j_1), (a_i_2, b_j_2), ... \}[/tex] under the function f.

Now, for the listed ordered pairs, checking if they're functions or not:

Case 1: (-2,-4), (-1, -2), (1, 2), (2, 4)

Each single input is connected with single output. So it is demonstrating a function.

Case 2: (-2, 4), (1, 2), (1, -2), (2.-4)

In this case, 1 is connected to 2, and -2 both. Thus, it's not representing a function.

Case 3: (-2,4), (-1, 2), (-1, 2), (-2,-4)

-1 is only connected to 2, but that does't help as  -2 is connected to -4 and 4 both. Thus, it doesn't represent a function.

Case 4: (-2, 4), (-1, 2), (-1, -2), (-2,-4)

-2 is connected to 4 and -4, and -1 is connected to 4 and -4, so its not a function.

Thus, the set of ordered pairs from listed options demonstrating a function is given by: Option A: (-2,-4), (-1, -2), (1, 2), (2, 4)

Learn more about functions here:

https://brainly.com/question/13395697

$140 spent on a 90-minute taxi ride

Answers

Dang bro they charged to much

3.14x(3x5)+34 hjghjhg

Answers

Answer:

81.1 is the answer ..,eksks

81.1 is the answer !

Solve the simultaneous equation
x2+y2= 26
X - Y = 4

Answers

The answer is X=1, y=5. X=-5 y=-1

guys help i only have 10 more minutes left ;-;

Answers

Answer:

20

Step-by-step explanation:

12 = 6/10 x

120 = 6x

x = 20

The diagram shows a solid metal cuboid.
The areas of three of the faces are marked on
the diagram.
The lengths, in cm, of the edges of the cuboid
are whole numbers.
The metal cuboid is melted and made into cubes.
Each of the cubes has sides of length 2.5 cm.
Work out the greatest number of these cubes that can be made.
You must show your working.

Answers

Answer:

6 cubes

Step-by-step explanation:

Considering the given cuboid, it can be deduced that;

length of the cuboid = 7 cm

width of the cuboid = 3 cm

height of the cuboid = 5 cm

Thus,

volume of the cuboid = length x width x height

                                    = 7 x 3 x 5

                                    = 105 cubic centimetres

The cubes has sides of length 2.5 cm.

volume of each cube = length x width x height

                                    = 2.5 x 2.5 x 2.5

                                    = 15.625 cubic centimetres

The greatest number of cubes that can be made = [tex]\frac{105}{15.625}[/tex]

                                              = 6.72

The greatest number of cubes that can be made from the cuboid is 6.

Tyler is simplifying the expression 6 − 2 + 5 + 4. Here is his work: 6 − 2 + 5 + 4
(6 − 2) + (5 + 4)
4 + 9
13
PLSSS HELP ASAP I HAVE A TEST

Answers

Answer:-2(2x + 5)2 i think

Step-by-step explanation:(8+4x)/4x= 4(2 + x)/4x= (2 + x)/x

worth 20 points!!!!!

Answers

Answer:

polygon B = 20 meters

Step-by-step explanation:

polygon A : polygon B

3 : 4

15 : x

first take 15 and divide by 3, this would tell us how much it went up by:

15 ÷ 3 = 5

next, take 4 and multiply it by 5:

4 x 5 = 20

this means that polygon B is 20 meters

Polygon B = 20 meters

Heera jogs 2 rounds of the park, whose length is 4.5 km and width is twice its length .Find the total distance covered by her .

Answers

Answer:

54 km

Step-by-step explanation:

The distance she covers would be equal to twice the perimeter of the park which is in the shape of a rectangle

perimeter of a rectangle = 2 x (length x width)

length = 4.5

width = 2 x 4.5 = 9

2 x (4.5 + 9) = 27km

In one walk, she covers a distance of 27km. In two walks, she covers a total distance of 27km x 2 = 54km

What is 4x - 18 + 3y?

Answers

Answer:

4x + 3y − 18

Step-by-step explanation:

Simply 4x - 18 + 3y = 4x + 3y − 18

Jen measured the growth of a sunflower. In week one, it grew 2 1/2 inches. In week two, it grew 2 3/4 Inches. In week three, it grew 3 1/4 Inches. How much did the sunflower grow over all the three weeks?

Answers

Answer:

8 1/2 inches

Step-by-step explanation:

we add the fractions of growth over the 3 weeks

2 1/2 + 23/4 + 3 1/4 = 8 1/2

Determine the value of each unknown angles.

HELP PLEASE DO ANY! I’ll give you brilliance

Answers

For D:

A triangle always has 180 degrees total. No more, no less. Seeing as though all the sides and angles are the same length, we can just divide 180 by 3, giving us 60. x = 60 degrees.

For E:

We can see there is a 90 degree symbol that surmises both angles. We know the lower angle is 30 degrees, so m must equal 60 degrees.

For G:

Same concept as D, except we gotta do a bit of math. A triangle always has 180 degrees, So we add 50 and 55 together and get 105. Subtract 105 from 180 and we get 75. Therefore, your angle is 75 degrees.

For H:

The 75 degree angle and m are parallel, with the same line passing through it, meaning that m is identical to the other angle. m = 75.

Answer:

d) x = 60

e) m = 60

g) q = 75

h) m = 75

Step-by-step explanation:

d) This image is that of an equilateral triangle, or a triangle whose sides are all equal (also known as a regular triangle). One property of an equilateral triangle is that all of its angles are also equal. Because the angles of a triangle add up to 180° (Triangle Sum Theorem), each angle would be 180/3°, or 60°, so x = 60.

e) This problem shows two complementary angles. Complementary angles are two angles that add up to 90°. Because one of the angles is given, you can find the other by subtracting the given one from 90°:

   m = 90 - 30

   m = 60

g) This is an image of a triangle with two given angles and the missing one is the third angle, q. You can solve for q using the Triangle Sum Theorem, which states that the three interior angles of a triangle add to 180°:

   50 + 55 + q = 180

   105 + q = 180

   q = 75

h) This image shows two parallel lines cut by a transversal. You can find m using the Corresponding Angles Theorem, which states that if parallel lines are cut by a transversal, the corresponding angles will be congruent. Because the lines are parallel, you know that m = 75 since the 75° angle is its corresponding angle.

Nate scored a 990 on his first autempton
the SAT and a 1140 on his second attempt





Percent of change classify as a percent increase or decrease

Answers

Answer:

It was a percentage increase of 15.15%

Step-by-step explanation:

1140 is greater than 990, so it is an increase in scores

Percentage increase = (change in score / first score) x 100

change in score = second score - first score

1140 - 990 = 150

(150 / 990) x 100 = 15.15%

Other Questions
If each of the cubes in a Rubik's Cube represented 1 cubic inch, what would be the volume of the Rubik's Cube? I see I thinkI wonder Read these sentences from "Letters to His Children". He is an exceedingly solemn, elderly gentleman with chin whiskers. He certainly does not look to be playful in nature. Which dictionary entry BEST defines nature as used in the sentence * What is the fundamental idea behind the Fourteenth Amendment to the Constitution, which is mentioned in Brown v. Board of Education?(A.) The Fourteenth Amendment makes slavery illegal in the United States.(B.) The Fourteenth Amendment secures the rights of citizenship to all Americans.(C.) The Fourteenth Amendment declares segregation of schools illegal in America.(D.) The Fourteenth Amendment offers voting rights to all American males. The cornering performance of an automobile is evaluated on a skid pad, where the maximum speed that a car can maintain around a circular path on a dry, flat surface is measured. Then the centripetal acceleration, also called the lateral acceleration, is calculated as a multiple of the free-fall acceleration g. The main factors affecting the performance of the car are its tire characteristics and suspension system. A Dodge Viper GTS can negotiate a skid pad of radius 61.0 m at 86.5 km/h. Calculate its maximum lateral acceleration. Please Help!!! Who was Ronald Reagan's intended audience for his speech "Remarks on East-West Relations at the Brandenburg Gate in West Berlin"? HURRY IM TIMEDWILL GIVE BRAINLIEST FOR RIGHT ANSWERWhich equation can be used to find 55 percent of 900?[tex] \frac{55 \times 1}{900 \times 1} = \frac{55}{900} \\ \\ \frac{100 \times 16.36}{55 \times 16.36} = \frac{1636}{899.8} \\ \\ \frac{900 \times 9}{100 \times 9} = \frac{8100}{900} \\ \\ \frac{55 \times 9}{100 \times 9} = \frac{495}{900} [/tex] Imagine you are part of a school exchange trip to Turkey. You have been asked to give a talk to the students in the Turkish school in which you explain what normal everyday life is like for people of your age in Ireland. Write the text of the talk you would deliver. PLS HELP. If the spinner shown below was used 100 times, how many times can you expect to spin a number greater than 3? 360240 Amanda slept for 1/3 of the day. She played with her friends for 1/5 of the day. She spent the rest of the day working on a school project. What fraction of the day did she spend working on her project What was the mood of the United States immediately after the election of 1804? How is the small intestine designed to absorb digested food ? if a woman wanted to be married to an upperclass man, what did she have to have under neoconfucianism Which statement accurately describes static electricity?O A. It is caused by positively and negatively charged particlesgathered together.B. It is caused by positively charged particles that flow.c. It is caused by only negatively charged particles on a surface.D. It is caused by separated positively or negatively chargedparticles. The diagram shows the apparent motion of the Sun across the sky. EAST WEST Sunrise Which action causes the Sun to appear to move in this way? A. Earth rotates from south to north. B. Earth rotates from north to south. C. Earth rotates from west to east. D. Earth rotates from east to west. Can yall help me on a question 15?! I need help please help me !!!!!! Please need help thank PLEASE GEOMETRY HELP WILL MARK BRAINLIEST!!! 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA