Which of the following is an example of an adaptation?

Which Of The Following Is An Example Of An Adaptation?

Answers

Answer 1

Answer:

B

Explanation:

The butterfly formed those adaptions so predators are less likely to eat it

hope this helps


Related Questions

People began to live together in locations that favored trade.
By 3000 b.C., several villages had developed into cities in
Sumer, a region in southern Mesopotamia
True
False

Answers

True.
People began to settle Sumer around 4500BCE. The Sumerians were in control of the area by 3000BCE. Their culture was comprised of cities such as Eridu, Nippur, Lagash, Kish, Ur, and Uruk.

When a plant drinks water the water has enters

Atmosphere
biosphere
geosphere
hydrosphere

Answers

Answer:

geosphere

Explanation:

What are examples of Geosphere?

It includes everything natural and lifeless that make up the surface of the earth. Examples are all the rocks and sand particles from dry land to those found at the bottom of the oceans. They also include the mountains, minerals, lava and molten magma from beneath the earth's crust.

Answer:

B. biosphere

Explanation:

The water that was in the hydrosphere has entered the roots of a plant and the plant is in the bioshere.

What are two major surfaces on the moon? Which is younger?

Answers

The two major surfaces of the moon are the maria and the highlands. The maria would be younger, since it has less craters than the highlands.

Hope this helps!

A cell placed in a high salt solution would swell because of osmosis.
A. True
B. False

Answers

Answer:

false

Explanation:

False

explanation :

shrink

Hope this helps

Which cells can form ATP by breaking down glucose?

a
Animals only
b
Prokaryotes only
c
All cells
d
Plants only

Answers

Answer:

C. All cells

Explanation:

Just took the assignment

Glucose is an organic compound produced during the process of photosynthesis. Select the word below that best describes glucose.

B. Nucleotide
A. Polypeptide
C. Monosaccharide
D. Steroid

Answers

Answer:

C. Monosaccharide

Explanation:

Glucose is an carbohydrate molecule with the chemical formula, C6H12O6. It is one of the simplest form of carbohydrates called MONOSACCHARIDE OR SIMPLE SUGAR. This means that it has a single ring in its chemical structure. Other monosaccharides are fructose, galactose etc.

As stated in this question, Glucose is produced as energy source during the process of photosynthesis in plants i.e. the combination of carbon dioxide (CO2) and water (H2O).

Use a Punnett's squares to show a monohybrid cross between pure breeding parents of tall (T) and dwarf (t) pea plants.
The tall trait is dominant and thus is represented by the uppercase letter "T". The dwarf trait is recessive and is represented by
to lowercase letter "t".

Answers

Answer/Explanation:

True breeding means the parents have two copies of the same allele (two of the same letter)

That means the monohybrid cross is TT x tt

      T            T

t      Tt          Tt

t      Tt          Tt

All the offspring have one copy of each and are Tt. Tall is dominant to dwa rf. So all the offspring will be tall.

I WILL GIVE 100 POINTS!!
You have learned that heat moves from warm areas to cooler ones. In solids, heat is transferred by the physical touching of molecules. This type of heat transfer is called conduction. Some materials, like metal, conduct heat better than other materials. In fluids (liquids and gases), heat is transferred by convection currents caused by differences in density.

MATERIALS
hot water
cold water
metal fork
plastic fork
stick of cold butter
large glass
watch or clock with a second hand
yellow and blue food coloring
playing card
four empty, identical plastic bottles (sports drink bottles work well)
access to a sink

QUESTIONS
Part 1
What type of heat transfer is demonstrated in Part 1?
How long did it take for the butter to melt off of the plastic fork? The metal fork?
How do explain the difference in time between the two forks?
Part 2
What type of heat transfer is demonstrated in Part 2?
What happened when the warm water bottle was placed over the cold water bottle? Why?
What happened when the cold water bottle was placed over the warm water bottle? Why?

Answers

Pt. 1

In gases and liquids, heat is usually transferred by convection, in which the motion of the gas or liquid itself carries heat from one place to another. ... If you boil water in a kettle, the heat is transferred through convection from the fire to the pot.

Pt. 2

This motion of fluids is called convection. In the set of bottles where the hot water was above the cold water, the cold water was already on the bottom, so there was no convection.

Pt. 3

When the bottle was put into the cold water, the air in the bottle contracted, taking up a smaller space in the bottle. The sides of the bottle pushed in when the air inside controlled

Karissa is conducting an experiment on the amount of salt that dissolves in water at different temperatures. She repeats her tests several times using the same procedure.
What can Karissa do to further increase confidence in the results of her experiment?

1.have another scientist run the same exact procedure in her lab

2.include several other liquids for comparison

3.calculate the average amount of salt that dissolves to summarize findings

4.make sure the experiment follows a specific procedure that allows other scientists to produce the same findings

Answers

Valid Expressions are; t = ∛(d²/va), a = d/t², a = √(vd/t³), v = at

while the Invalid expressions are;  v = a/t and  d = at

Explanation:

Given expressions

1) v = a/t

2) t = ∛(d²/va)

3) d = at

4) a = d/t²

5) a = √(vd/t³)

6) v = at

First we get our units of parameters

V = m/s, t = sec, d = m, a = m/s²

so

1)

v = a/t

we substitute in our units of parameters

v = m/s² / s = m/s² × 1/s = m/s³

v ≠ m/s³

therefore it is false

2)

t = ∛(d²/va)

we substitute

t = ∛(m² / m/s × m/s²)

t = ∛(m² / m²/s³)

t = ∛(s³)

t = s

correct, the expression is true

3)

d = at

we substitute

d = m/s² × s

d = m/s² × s/1 =  ms/s² = m/s

d ≠ m/s (because d = m)

so expression is false

4)

a = d/t²

we substitute

a = m / s² = m/s²

correct

the expression is true

5)

a = √(vd/t³)

we substitute

a = √(m/s×m / s³) = √(m²/s / s³) = √(m²/s × 1/s³)  = √(m²/s⁴) = m/s²

so a = m/s²

correct

the expression is true

6)

v = at

we substitute in the units

v = m/s² × s = m/s² ×s/1 = ms/s² = m/s

v = m/s

correct

the expression is correctValid Expressions are; t = ∛(d²/va), a = d/t², a = √(vd/t³), v = at

while the Invalid expressions are;  v = a/t and  d = at

Explanation:

Given expressions

1) v = a/t

2) t = ∛(d²/va)

3) d = at

4) a = d/t²

5) a = √(vd/t³)

6) v = at

First we get our units of parameters

V = m/s, t = sec, d = m, a = m/s²

so

1)

v = a/t

we substitute in our units of parameters

v = m/s² / s = m/s² × 1/s = m/s³

v ≠ m/s³

therefore it is false

2)

t = ∛(d²/va)

we substitute

t = ∛(m² / m/s × m/s²)

t = ∛(m² / m²/s³)

t = ∛(s³)

t = s

correct, the expression is true

3)

d = at

we substitute

d = m/s² × s

d = m/s² × s/1 =  ms/s² = m/s

d ≠ m/s (because d = m)

so expression is false

4)

a = d/t²

we substitute

a = m / s² = m/s²

correct

the expression is true

5)

a = √(vd/t³)

we substitute

a = √(m/s×m / s³) = √(m²/s / s³) = √(m²/s × 1/s³)  = √(m²/s⁴) = m/s²

so a = m/s²

correct

the expression is true

6)

v = at

we substitute in the units

v = m/s² × s = m/s² ×s/1 = ms/s² = m/s

v = m/s

correct

the expression is correct

What are the approximate coordinates of the star Rigel?

Answers

Answer:

approximately 860 light-years (260 pc) from Earth

explain conservation of matter in nature

Answers

Answer:

Conservation of matter in nature is that things cannot be magically created or destroyed.

Explanation:

Which natural hazard is least likely to affect Florida?
A drought
B wildfire
C rip current
D tsunami

Answers

Answer:

c I think I'm taking the test atm

Explanation:

Answer:

d

Explanation:

quizlet

if the values for both mass and volume double, the value of the density will be?

Answers

Answer:

Stays the same.

Explanation:

Density = mass/volume

So if :

M/V = D

And if we were to double mass(M) and volume (V)

2M/2V = D

It will stay the same because the 2 and 2 would cancel out and we'd get the same density as the original value.

This is confusing for me so, first answer gets brainly Est PLEASEEEE
"Can dogs identify colors?" is an example of a scientific question. "Are dogs better pets than cats?" is not. Use complete sentences to explain the difference between these questions and why only one is scientific.

Answers

Answer:

"Can dogs identify colors?" is scientific while "Are dogs better pets than cats?" is not.

Explanation:

"Can dogs identify colors?" is scientific because it is a hypothesis that can be tested, it avoids opinion, it is specific, and the experiments involved in proving it can be repeatable. These are all characteristics of a good scientific question. "Are dogs better pets than cats?" is not scientific because it is opinionated, and it does not involve any experiments that would fail or prove it.

Allen Dexter, a 19-year-old college student, was rock climbing when he fell 30 feet to the ground. Paramedics arriving at the scene found him lying in the supine position, unable to move any extremities and complaining of neck pain. He was alert and oriented to his current location and the details of his fall. He complained that he could not feel his arms and legs. His pupils were equal and reactive to light. His vital signs revealed a blood pressure of 110 / 72 and a heart rate of 82 beats per minute. Breathing was steady but shallow. The paramedics immobilized his neck and transported him to the trauma center. Upon examination Allen had some sensation in his arms, but could not localize touch or describe texture. He was able to raise his shoulders and tighten his biceps brachii slightly in each arm, but could not raise either arm against gravity. His lower extremities were flaccid, despite attempts to move them. Vital signs were taken again at the hospital and were as follows: blood pressure=94 / 55; heart rate=64; respiratory rate=24 (with shallow breathing). His oral temperature was 102.2 degrees F. His color was dusky and his skin was warm and dry to the touch.

X-rays taken upon arrival revealed a fractured vertebra at the C5 level. A chest X-ray showed a decreased lung expansion upon inhalation. Blood tests were normal, with the exception of a respiratory acidosis (blood pH = 7.25). The neurosurgeons immobilized his neck by inserting tongs into the skull above the ears to hold his neck in a position so that no further injury could occur. Allen was transferred to intensive care and his condition was stabilized.

A physical examination four days later revealed normal vital signs and no change in his arm strength or sensation, but also marked spasms and exaggerated stretch reflexes of the lower extremities. He also had urinary incontinence which required the placement of a Foley catheter connected to a urine collection bag.

Required:
a. Why did the paramedics apply a cervical collar, place him on a back board and immobilize his head?
b. How would the paramedics test Allen's pupils reaction to light and what would the anticipated normal response be when exposed to light?
c. List his vitals on the scene of the accident and compare them to his vitals at the hospital when he arrived and four days post surgery.
d. What did the x-rays reveal?
e. What did blood tests reveal?
f. Describe the surgical procedure that was performed?
g. What were the physical findings four days post op?

Answers

Answer:

Explanation:

A cervical collar was used to avoid movement and prevent further damage incase he has a fracture.

light is focused in one eye,the pupil will constrict as a respond to the light flashed. It is repeated Again and observed.

The vitals were normal until he had the accident as the patient reached hospital his vitals were abnormal he had achycardia, severe hypotension, increased temperature and shallow breathing which is an indicator of C5 injury. After the surgery and the patient was treated he stabilises and achieved his vitals normal ranges in day 4 of admission.

The X ray result shows he has fracture of the 5th cervical bone.

The blood test shows he has a decreased pH level and an alteration in

his breathing pattern shows he has respiratory acidosis

Cranial tongs was uses to immobilize the neck and prevent it from moving it also aid healing

After the operation it was revealed that he has a damage on both sides of of his 5th Cervical bone which has lead to loss of sensation and strength in his upper arms and lower .It leads to incontinence in urine.

During the process of replication, a molecule of DNA unzips, forming two single strands what makes up each individual strand of DNA?
A( paired adenine and uracil bases
B( Paired thymine and guanine bases
C( sugar groups attached to individual amino acids
D( nitrogenous bases attached to a sugar- phosphate backbone

Answers

It's D :) hope this helps <3

DNA is a nucleic acid that gets duplicated by replication. The single strand of DNA is made of nitrogenous bases attached to a sugar-phosphate backbone. Thus, option D is correct.

What is DNA?

DNA is the abbreviated form of deoxyribose nucleic acid that is the major molecule involved in inheritance and genetics. DNA undergoes a replication process where the two daughter strands, semiconservative in nature are produced.

The DNA is a polymer composed of the sugar (deoxyribose) - phosphate backbone along with nitrogen bases that include adenine, thymine, cytosine, and guanine. The phosphodiester bond, hydrogen bond, and glycosidic bonds are involved in interlinking the structural framework.

Therefore, option D. the sugar-phosphate backbone linked to the nitrogenous bases makes the structure of DNA molecule.

Learn more about DNA here:

https://brainly.com/question/13522078

#SPJ2

Given the sequence ATGGCGAATCACGTCACTTGA
a) Write the sequence of nucleotides for the complementary strand of DNA.
b) Write the mRNA sequence transcribed from the complementary strand.
c) What is the tRNA sequence that would be used to translate this sequence?
d) Convert the message into an amino acid sequence.

Answers

Answer:

a. TACG

b.UAC CGC UUA GUG CAG UGA ACU

c.ATCG

d.ser-arg-leu-val-ser-stop-thr

Explanation:

Potatoes are native to Monuntainous areas of Bolivia and Peru in South America, but are now grown widely around the world. What kinds or environmental conditions do you think areas must have in common for a crop to be successful around the world?

Answers

Answer:

Potatoes grew in the mountainous regiosn of Bolivia and Peru because they prefers such climates. Climates that are on the cold side but not so cold that the ground would be frosty. A temperature of between 60° to 70°F is considered ideal and anything above 80° F is considered too warm for them even though they have been known to adapt.

The soil should be very mildly acidic with a pH of between 5.0 to 5.5. Potatoes prefer to be grown in the full presence of the sun in well drained soils that are not compact or constantly wet.

The Environmental conditions are therefore;

Cold but not too coldWell drained soilMildly acidic soil.Abundance of sunlight.

What are the importance of family resources?

Answers

Search Results
Featured snippet from the web
Families are the most important economic units in society. A human resource (children) causes a need to manage other resources (money, energy, time). Resource management can help strengthen relationships. Families will always need resource management to survive.

Men who are “benevolent sexist” have positive feelings about women as a group but,

Answers

Answer:

w

Explanation:

w

Answer:

Men who are "benevolent sexists have positive feelings about women as a group but men based on shows that women have difficulty identifying benevolent sexist acts as sexist or negative emotional associations between particular attributes and groups.

Explanation:men

HELP PLEASE !!!
Fahrenheit and centigrade temperatures are related by the formula C = 5(F - 32) / 9 , where and F represent the temperatures in °C and ° F respectively . If the directions for a chemical experiment require that the temperature of a certain liquid be kept between 25 ° C and 30° C , what range of temperatures in ° F will satisfy the temperature restrictions of the liquid ?

Answers

Answer:

like this question

Explanation:

I will be giving example only

How does a enzyme work?
Using these words
“Speeding up the.... by lowering the...”

Answers

Like all catalysts, enzymes work by lowering the activation energy of chemical reactions.

Could someone help me plz!

Answers

Answer:

I think that D is the correct answer

the answer is D if i’m correct

temperature of water in morning

Answers

Preferably, take a cup of warm water in the morning, to stimulate the movement of the intestine, as hot water helps to relax the blood vessels and the digestive tract and thus stimulate digestion. Taking a cup of lukewarm water keeps the body balanced and promotes the body's persistence by applying all its functions
Warm water helps the body

Juanita and Alfred hypothesize that a seed will sprout faster if it is warmer. They plant three seeds and water them the same amount. One seed is placed near a heater, one is left at room temperature, and one in a refrigerator. The results are shown in the table below. Do the results support the hypothesis?

Temperature of Seed Days to Sprout
by heater 2 days
room temperature 5 days
in refrigerator did not sprout
A.
No, because the seeds all sprouted at the same time.
B.
Yes, because the cooler seeds sprouted sooner.
C.
Yes, because the warmer seeds sprouted sooner.
D.
No, because the cooler seeds sprouted sooner.

Answers

Answer:

C

Explanation:

Yes, because the warmer seeds sprouted sooner.

Yes, because the warmer seeds sprouted sooner.

What is Room temperature?

The typical temperature range in a home is widely agreed to be between 68 and 76 degrees Fahrenheit, specific variations and geographic variations aside.

The use of smart home appliances, such as a smart AC controller, automates the maintenance of these typical house temperatures at all times, however keeping the ideal room temperature is a challenge.

The location, season, type of house, and personal preferences are just a few of the many variables that can dramatically affect the appropriate room temperature. When determining appropriate room temperatures, home architecture is a crucial factor.

Therefore, Yes, because the warmer seeds sprouted sooner.

To learn more about Warmer seeds, refer to the link:

https://brainly.com/question/7589654

#SPJ2

g Identify the statements that accurately describe how hydrogen ion concentration relates to energy production in oxidative phosphorylation. Hydrogen ion concentration is lower in the mitochondrial matrix than in the intermembrane space. The pH in the mitochondrial matrix is lower than the pH in the intermembrane space. Energy is generated as a result of the difference in hydrogen ion concentration between the intermembrane space and the cytoplasm. Oxidative phosphorylation relies on the hydrogen ion concentration gradient generated and maintained by the electron transport chain. Hydrogen ions enter the mitochondrial matrix via facilitated diffusion.

Answers

Answer:

- Hydrogen ion concentration is lower in the mitochondrial matrix than in the intermembrane space.  

- Oxidative phosphorylation relies on the hydrogen ion concentration gradient generated and maintained by the electron transport chain.  

- Hydrogen ions enter the mitochondrial matrix via facilitated diffusion.

Explanation:

Oxidative phosphorylation is a metabolic pathway by which Adenosine Triphosphate (ATP) molecules are produced through the transfer of electrons from NADH or FADH2 to molecular oxygen (O2). The hydrogen (H+) ions are pumped from the mitochondrial matrix to the intermembrane space, and this movement of protons generates an electrochemical gradient across the mitochondrial membrane which is used by the ATP synthase to produce ATP. This gradient is generated by the movement of electrons through a series of electron carriers (e.g., cytochrome c and ubiquinone) that are embedded in the inner mitochondrial membrane. The movement of these H+ ions across the semipermeable mitochondrial membrane moving down their electrochemical gradient is named chemiosmosis and is an example of facilitated diffusion.

Which are examples of harmful mutations? Check all that apply. one that causes a person to have a light patch of hair color one that changes a mouse’s eye shape but not its eyesight one that allows a moth to blend into its environment one that reduces a bean plant’s ability to make food one that increases the plants susceptibility to diseas

Answers

When that reduces a bean plants ability to make food and one that increases the plants susceptibility to disease

Answer:

2, 4, 5

Explanation:

Which type of molecule forms the cell membrane?
O phospholipid
O nucleic acid
O protein
O carbohydrate

Answers

Answer:

A. phospholipid is a molecule that forms the cell membrane.

What are the properties of Oxygen Chalcogens and what is it used for?

Answers

The properties of Oxygen Chalcogens are, oxygen, sulfur, selenium, tellurium and polonium. It is used to make acids, sulfuric acids, nitric acids, and other compounds.

can anyone please tell why the bell jar is covered with black cloth in test for carbon dioxide ?​

Answers

Answer:

To test

Explanation:

test

Other Questions
Which is one use for radioactive isotopes? What happened in the end of the baleks scale? what would happen if glycosis stopped happening in a cell In one or two sentences summarize how Booker T. Washington planned on helping African Americans. Which expression is equivalent to 3/6 divided by 7/9 *BRAINLIEST* What values are equal to the inequality? Which scenario best reflects the relationship between production and demand in a recession?O Car dealerships have minimal overstock.Car dealerships are not restocking.Car dealerships cannot sell their stock.O Car dealerships cannot obtain stock.OdAnswer Help please........... The length of a day on Earth is 24 hours. The length of a day on Mercury is 58 2/3 times the length of a day on earth. The length of a day on Mercury in hours is Think of a time when you struggled to learn something and gave up before fully learning it. Why did you give up? How did you feel when you gave up? Was it something you really wanted to learn? How might your life be different now if you had learned that skill? Please answer the following question.... meaning of astrophysics b) identify ONE major economic development in Eurasia in the period circa 1200-1450 that is illustrated by the passage. What was a result of Napoleons economic reforms in France?Taxes were based on fixed rates and were no longer a surprise. The lower classes were no longer required to pay taxes.Tax collection was localized, and it differed from region to region.Only people in the upper classes had to pay taxes. Arrange the fraction in asending and desending order 4/5 , 2/15 , 2/30 when was the first blue print made? Which passage describes a violent battle scene? A. And now I would have come home unscathed to the land of my fathers, But as I turned the hook of Maleia, the sea and currentAnd the North Wind beat me off course, and drove me on past Kythera. B. But when the fair-haired Dawn in her rounds brought on the third day we, setting the masts upright, and hoisting the white sails on them, sat still, and let the wind and the steersmen hold them steady. C. Both sides stood and fought their battle there by the running ships, and with bronze-headed spears they cast at each other, and as long as it was early and the sacred daylight increasing, so long we stood fast and fought them off, though there were more of them. D. would not suffer the flight of my oarswept vessels until a cry had been made three times for each of my wretched companions, who died there in the plain. What grammatical structure is the italicized portion of the sentence?We walked along the mountain path (looking for unusual flowers).present participial phrasenominative absoluteappositivepast participial phraseprepositional phrase with a gerund You are considering a certain telephone company. They charge $0.19 per minute of talking, plus a fixed base monthly fee of $70. If M represents the number of minutes you talk in a month, and C is the total monthly charge, which of these is the correct relationship between M and C? Can u see bubbles in chemical reactions