An example of biotic component of an ecosystem is cockroach (b).
Ecosystem : Abiotic and Biotic
Ecosystem involves the interaction between biotic and abiotic factors. Abiotic are the non-living components that impact the biotic. The biotic factors are living things within in ecosystem. These factors influence each other.
According to Whittaker, living things are divided into five kingdoms: monera, protist, fungi, animal and plant. As a living thing, cockroach is an example of animal, while the climate, water and synthetic pesticides belong to abiotic factors.
Thus, from all options, cockroach is a part of biotic component.
Learn more about ecosystem at :
https://brainly.com/question/29013940
#SPJ4
1. What types of cells contain chloroplasts?
2. What is the energy autotrophs use to make their own food?
3.The food making process is called: ____________
4.What are the raw materials for photosynthesis?
5.What simple sugar is produced?
6.What gas is used? ____________ What gas is released? ____________
7.Where are most photosynthetic cells in plants found?
8. About how many chloroplasts can be found in photosynthetic cells?
9. How many membranes surround a chloroplast?
10. The outer membrane is:____________
11. The individual sacs formed by the inner membrane are called ___________ and are arranged in __________ like pancakes.
12. What pigment is found inside a thylakoid? ____________ What color will it be in real cells?
13. Other pigments that trap sunlight are called a____________ pigments. What colors are these pigments?____________________________________
14. Stacks of thylakoids are called G____________(plural) or Granum (singular).
15. Stacks or grana are connected to each other by____________.
Answer:
1. plant cells
2. energy from the sun
3. Photosynthesis
4. water and carbon dioxide
5. glucose.
6. carbon dioxide
7.leaves
8. 100
9. 2
10. an integral component of the cell envelope of Gram-negative bacteria
11. thylakoids,stacks
12. Chlorophyll, green
13. yellow and orange
14. grana
15. lamellae
Explanation:
:)
complete the t-chart by categorizing each environmental factor as something that would most likely increase or decrease genetic variation. some answers will fit in both columns depending on the situation. predator-prey relationships ___competition ___toxins ___new habitat ___disasters ____ increased food source ____
Complete the t-chart by categorizing each environmental factor as something that would most likely increase or decrease genetic variation. some answers will fit in both columns depending on the situation. predator-prey relationships decreases, competition decrease, toxins increase and decrease, new habitat decrease and increases, disasters decrease, increased food source increase.
Genetic variation are basically the alterations in the DNA sequences between the individuals who are a part of a population. Variation basically occurs in the germ cells, that is, sperm as well as the egg, and also occurs in somatic as well as all the other cells.
The number of different sources of genetic variation basically include mutation as well as genetic recombination. Mutations are considered as the ultimate sources of the genetic variation, but mechanisms, such as genetic drift also contribute. Due to it, there is a decrease in the predator-prey relationship as well as in competition and disasters which increases the food sources.
To know more about genetic variation here
https://brainly.com/question/848479
#SPJ4
fill in the blank. baroreceptors necessary for the baroreceptor reflex are located at the___.question 6 options:a) juxtaglomerular apparatus of the kidneyb) aortic sinus and the carotid sinusc) left and right atriad) internal and external jugular veins
The correct option is B ; Aortic sinus and the carotid sinus , Baroreceptors are mechanoreceptors that are found in the carotid sinus and aortic arch. Their job is to detect pressure changes by reacting to variations in artery wall tension.
Baroreceptors are sensory nerve endings found in the carotid sinuses, the aortic arch, and the right carotid and subclavian arteries . Changes in arterial blood pressure are detected by nerve endings.
Baroreceptors are spray-type nerve endings found on the walls of blood arteries and the heart that are activated by changes in arterial pressure. They are especially plentiful in the wall of the internal carotid artery bifurcation (carotid sinus) and the aortic arch.
Learn more about Baroreceptors
https://brainly.com/question/29618046
#SPJ4
Full Question ;
fill in the blank; Baroreceptors necessary for the baroreceptor reflex are located at the___.
question 6 options:
a) juxtaglomerular apparatus of the kidney
b) aortic sinus and the carotid sinus
c) left and right atria
d) internal and external jugular veins
Though dark and light phenotypes existed among the moth populations, an albino moth was recently discovered. Complete the data below in order to better understand how this may DNA = ATCG happen. Complementary rules MRNA-UAGS Dark moth - Dominant allele: DNA: TACCGTCGCATACACTGGGGTCAGGACGAGTCGCATCCAGACGGGTCGTCGGACATGATC mRNA: AAS: Light moth Recessive allele: DNA: mRNA: AAS: Albino moth DNA: mRNA: AAS: - TACCGTCGCATACACTGGGGTTAGGACGAGTCGCATCCAGACGGGTCGTCGGACATGATC Unknown allele: TACCGTCGCATACACTGGGGTCAGGACGAGATCGCATCCAGACGGGTCGTCGGACATGATC When responding below, be sure to use the precise terms for the mutations when appropriate. Write a claim to answer this question: What you think occurred to produce the dark and light phenotypes? Provide specific evidence from the mRNA-amino acid sequences for this claim: Propose a hypothesis as to what occurred to produce an albino moth:
By 1900, the peppered moth populations in areas around English cities were as much as 98% dark moths. Scientists became curious why this was happening.
What are dark moths?Eggs from light moths developed into light moths and dark moth eggs turned to dark adults. The dark color was caused by a mutation in the DNA of a single moth, and the mutated gene had been passed to all its offspring.
Why did dark moths have an advantage?As the trees darkened with soot, the light-colored moths were easier to see. They were eaten by birds more and more, while the rare dark colored moths blended in better on the darker trees. This made the dark colored moths have a higher survival rate.
To know more about dark moths visit
https://brainly.com/question/14452844
#SPJ1
Describe protein folding. What causes an amino acid chain to fold?
Answer:
The process where proteins are folded into specific, three-dimensional shapes in order to function correctly, this is an essential cellular process. The endoplasmic reticulum is a cellular compartment where protein folding takes place.
Explanation:
the introductory passage describes how vibrio cholerae bacteria can take up genes from their prey through horizontal gene transfer. based on the introductory passage and the material in the chapter, classify the following examples of gene transfer as horizontal gene transfer, vertical gene transfer, or neither. drag and drop choices into the bins they describe.
A virus-recognized attachment receptor has undergone mutation on the surface of the host cell.
What is a gene, plainly speaking?The basic structural and operational unit of heredity is the gene. the DNA that constitutes genes. Sometimes, genes act as the building blocks for the production of proteins. In contrast, a significant portion of genes do not code for proteins.
A gene example is exactly what?The genes you inherit determine a variety of traits, including your skin and hair hues. Emma's mother might have two genes—one for brown hair and one for red hair—and may have passed one of them on to her. If her father possesses two genes for red hair, she might have it.
To know more about Gene visit:
https://brainly.com/question/8832859
#SPJ4
Which of the following accurately describe how climate is affecting species across the planet? Select all that apply. Check All That Apply - Habitats are changing rapidly beyond those that a species can tolerate.- Habitats are being lost and are affecting species abunclance. - Habitats are changing rapidly, and these changes are affecting species behavior and their ability to adapt and survive in these new conditions.- As habitats change, species are moving to areas that they previously have never been recorded. - Habitat loss is only affecting a few relatively unknown species.
The statement that accurately describes how climate is affecting species across the planet is Habitats are changing rapidly, and these changes are affecting species' behavior and their ability to adapt and survive in these new conditions.
The c correct option is B.
What is climate change?Long-term changes in temperature and weather patterns are referred to as climate change. These changes may be organic, but since the 1800s, human activity has been the primary cause of climate change. This is mainly because burning fossil fuels, such as coal, oil, and gas, release gases that trap heat.
The destruction of rainforests and the burning of fossil fuels are just two examples of human actions that have an increasing impact on the climate and temperature of the Earth. This increases the number of greenhouse gases already in the atmosphere, amplifying the greenhouse effect and contributing to global warming.
Learn more about climate change at: https://brainly.com/question/1789619
#SPJ1
Characteristics of allergic purpura lesions include which of the following? (Select all that apply.)a. Fever and itching b. Easily palpatated lesions c. Bleeding from the lesionsd. Lesions located on the facee. Lesions located on the trunk
The characteristics of allergic purpura are fever and itching, easily palpated lesions. The correct option is Option A.
Henoch-Schoenlein purpura (also known as IgA vasculitis) is a common disorder that causes the small blood vessels under the skin, joints, intestines and kidneys to become inflamed and tend to bleed. Purpura lesions are generally itchy and fever can also occur due to these lesions. They are raised and are usually easily felt. Bleeding from the lesions themselves and generalized bleeding are uncommon. The lesions due to purpura tend to be found on the proximal extremities, especially on the legs and buttocks. The identifying feature of this form of vasculitis is the appearance of purplish rash, typically found on the lower legs and buttocks. It can also lead to abdominal pain and aching joints. Sometimes, chronic kidney damage can also occur.
For further learning about Purpura, refer to the link: https://brainly.com/question/26564682
#SPJ4
Suppose we are going to set up a Punnett square that concentrates on the smooth/wrinkled nature of the peas produced in a pea plant ("S" for smooth, "s" for wrinkled) and color of the pea produced ("Y" for yellow and "y" for green). What are all possible allele combinations for the gametes produced by a plant that is heterozygous in both traits?
SY, Sy, sY, and sy. A single gene in pea plants regulates pea texture. Smooth (S) peas outnumber wrinkly (S) peas in dominance.
A plant that produces wrinkled peas is bred with a plant that produces smooth peas. 252 of the offspring are wrinkle-free and 247 are smooth. Round (R) and Wrinkled (W) are the two alleles that determine the form of the seeds (r). The round form is dominant, whereas the wrinkled shape is recessive. Now, the genotype must be recessive homozygous for the wrinkly phenotype to manifest. As a result, rr is the genotype for the wrinkled phenotype. Pair the stray with a cat that doesn't curl. If there are any progeny with the "curl" characteristic, it is probably dominant.
Learn more about recessive here:
https://brainly.com/question/18075358
#SPJ4
The following multi-hybrid cross is made:
Aa BB C′C Dd E′E′ ff G′G X Aa Bb C′C dd E′E′ Ff G′G.
Note that the genes A, B, D, and F exhibit complete dominance (represented with capital and lower case letters), and the genes C, E, and G exhibit semidominance (aka intermediate dominance) represented with alleles with capital letters and a prime symbol.
(a) How many different genotypes might you expect to get in the offspring? (Enter your answer as a number)
(b) How many different phenotypes might you expect to get in the offspring? (Enter your answer as a number).
As stated in the preceding statement (a). You could anticipate finding 216 distinct genotypes in the progeny. (b). You could anticipate receiving 72 distinct phenotypes in the progeny.
How can a genotype be determined?In a single experiment, the polymorphisms at trillions of sites in a genome may be determined using Genotyping and other techniques. Some genetics influence an individual's phenotype, or observable qualities.
Aa BB C′C Dd E′E′ ff G′G X Aa Bb C′C dd E′E′ Ff G′G.
When Aa & Aa cross, the children may have one of three genotypes: AA in 1/4, Aa with 1/2, nor aa in 1/4 frequency, as well as two phenotypes.
Because BB and Bb cross, the child may have two genotypes: BB in half, Bb in half and one phenotype.
When C'C & C'C cross, the probable genotype of the progeny is C'C' with 1/4, C'C for 1/2, and CC throughout 1/4 frequency, along with three phenotypes. a trio of genotypes.
The progeny's potential genotype is Dd in 1/2, dd in 1/2 frequency, two phenotypes, and two genotypes where Dd and dd cross.
When E'E' or E'E' cross, all of the E'E' 1 phenotypes and genotypes are available in the offspring.
Whenever ff and Ff cross, the progeny's potential genotype is Ff throughout 1/2, ff in 1/2 therefore two phenotypes, and two genotypes.
When G'G or G'G cross, the potential genotype of the progeny is G'G' is 1/4, G'G in 1/2, or GG in 1/4 frequency, along with three morphologies and three genotypes.
There are 216 genotypes overall (3*2*3*2*1*2*3).
Total Phenotypes: 72 phenotypes (2*1*3*2*1*2*3).
To know more about Genotypes visit:
https://brainly.com/question/21765541
#SPJ4
Your breathing rate is mostly controlled by your brain. It can sense how much carbon
dioxide is in your blood. What do you think happens when the brain senses an
increasing level of carbon dioxide in blood?
A. Your breathing rate decreases.
B. Your breathing rate stays the same.
C. Your breathing rate increases.
D. Your breathing stops.
When the brain senses an increasing level of carbon dioxide in blood, your breathing rate increases. Therefore, the correct option is C.
What is breathing rate?It is also referred to as respiratory rate. Breathing rate is defined as the rate or the number of breaths a person takes per minute.
In adults, the normal respiration rate is 12–20 rpm, whereas the normal respiration rate for children is between 20 and 30 rpm.
Breathing rate depends upon the activities that you are carrying out. If you are running or doing exercise, your breathing rate increases as there is an increase in the level of carbon dioxide.
Therefore, the correct option is C as your breathing rate increases.
Learn more about breathing rate, here:
https://brainly.com/question/22600763
#SPJ9
Fill in the complimentary RNA sequence for the DNA sequence below if this sequence was being transcribed into messenger RNA: AAT CGA CTT ACC GCA TAT AGT ACT _______________________________________
The following RNA sequence would be complementary to the given DNA sequence:
UUA GCU GAA UGG CGU AUA UCA UGA
Using the base-pairing laws between DNA and RNA, we may get the corresponding RNA sequence for the provided DNA sequence.
Uracil pairs with adenine (A) (U)Guanine pairs with cytosine (C) (G)Cytosine (C) couples with guanine (G) (C)Adenine (A) couples with thymine (T) (A)Keep in mind that U rather than T is used to create RNA during transcription, which is complementary to the template strand and occurs in the 5' to 3' orientation.
The RNA may be generated in accordance with the genetic information contained in the DNA thanks to the complementary pairing of bases between DNA and RNA. The base pairing regulations also have an impact on RNA folding and splicing, among other functions.
To know more about the base-pairing between DNA and RNA:
https://brainly.com/question/20949471
#SPJ4
Brendan made a chart to categorize the characteristics
of animals.
Characteristics of Animals
Always
Sometimes
Which phrase should be written in the column titled
"Sometimes"?
O Are multicellular
O Have membrane-bound organelles
O Produce their own food
O Display an asymmetrical body plan
"They are multicellular" phrase should be written in the column titled "Sometimes". Therefore, option A is correct.
What are the characteristics of animals?Animals belong to the biological kingdom Animalia and are multicellular, eukaryotic creatures. Animals generally eat organic matter, breathe oxygen, can reproduce sexually, and form from a hollow ball of cells called a blastula during early development.
They are heterotrophic, they depend on producers for their food.
"They are multicellular" phrase should be written in the column titled "Sometimes". Therefore, option A is correct.
Learn more about animals, here:
https://brainly.com/question/9031447
#SPJ9
What is its genotype?......
Answer:
The genotype of a organism refers to the genetic makeup of that organism, which is determined by the combination of alleles (variations) in its DNA. In simpler terms, it is the particular set of genes that an organism has inherited from its parents. A genotype helps to determine an organism's phenotype (physical characteristics), which can be seen and observed.
Which of these big differences do you see between the sheep heart and the heart models in the lab manual?
A. the sheep heart has no chordae tendineae
B. the sheep heart does not have four chambers
C. the sheep heart does not have an apex
D. the sheep heart does not have an interventricular septum
E. all vessels on the sheep heart are the same color brown
The big difference between the sheep heart and the heart models in the lab manual is all vessels on the sheep heart are the same color brown.
Thus, the correct option is E.
What are the differences between a sheep heart and a human heart?The sheep heаrt is more ventrаlly tilted аlong its long аxis thаn is the humаn heаrt аnd hаs а relаtively blunt аpex formed entirely by the left ventricle. Whereаs the normаl heаrt weight:body weight rаtio in аdult humаns hаs been reported to be 5 g/kg, the rаtio in sheep is 3 g/kg.
In the sheep heart models in the lab manual, all vessels on the sheep heart have the same color brown. It is because all vessels on the sheep's heart haven't a brown color. Only the left and right auricle has a brown color.
For more information about the sheep heаrt refers to the link: https://brainly.com/question/19425396
#SPJ4
which pair of locations listed below share the most similar longitude lines
The pair of locations listed below that share the most similar longitude lines is Letters E and B.
The correct option is C.
What are longitude lines?Meridians, which are also known as lines of longitude, are imaginary lines that split the globe. They quantify the distance either east or west, running from pole to pole from north to south. The prime meridian has a longitude of 0 degrees and passes through Greenwich, England.
The letters E and B are on the same longitude line.
Learn more about longitude lines at: https://brainly.com/question/17355844
#SPJ1
On a chromosome, a section of DNA sequence coding for information for a feature of an organism, such as flower color, is a(n)______, and different versions of this sequence, which impact a feature are called_______. explain your answer.
O allele; genes
O allele; characters
O gene; alleles
O gene; character
P chromatid; non sister chromatid
On a chromosome, a section of DNA sequence coding for information for a feature of an organism, such as flower color, is a gene, and different versions of this sequence, which impact a feature are called alleles.
A DNA sequence is a precise arrangement of the (deoxyribonucleotides) building blocks of DNA, which contain four distinct nucleotides: adenine (A), guanine (G), cytosine (C), and thymine (T). The sequence of nucleotides in a DNA sequence encodes genetic information that cells employ to generate certain proteins and execute various activities. The letters A, G, C, and T, which represent the nucleotides in the sequence, are commonly used to symbolise the DNA sequence. The genetic information stored in the DNA sequence is determined by the exact arrangement of these letters.
A gene is a piece of DNA that codes for a certain attribute or feature of an organism, such as flower colour. Alleles are different forms of the same gene that might result in phenotypic differences. In the instance of flower colour, for example, various alleles might result in different colours such as red, blue, or white.
For more such questions on chromosome, click on:
https://brainly.com/question/11912112
#SPJ4
Cody slips his little finger into the hand of his newborn infant, who immediately grasps onto it. The infant is exhibiting the ____ reflex.
Cody slips his little finger into the hand of his newborn infant, who immediately grasps onto it. The infant is exhibiting the _Palmar_ reflex.
What is Palmar reflex ?When pressure and touch are provided to the newborn's palm, the palmar grip reflex enables them to clutch an object, although this action is not voluntary. Unfisting is the first clearly apparent fine motor skill necessary for appropriate growth.
One of the many infant reflexes that develops at birth is the palmar grip reflex, which enables your baby to close her fingers around an object put in her palm. Because of this, she will clench her fist and cling on hard when you put your finger or a little toy in her hand.
Learn more about Palmar reflex here:
https://brainly.com/question/3230071
#SPJ1
All freshwater on Earth was once saltwater in the ocean. Through the hydrologic cycle, water moves continuously on Earth's surface, as well as within it and above it. The hydrologic cycle is completely _______________________.
O solar poweredO wind powered
The hydrologic cycle is completely solar powered.
What is hydrologic cycle?The hydrologic cycle, commonly referred to as the water cycle, is the ongoing process of water movement on, above, and below the Earth's surface. It entails the evaporation of water from the Earth's surface, the transport of water through the atmosphere, the condensation of water vapor into clouds, and the final precipitation of water back onto the Earth's surface in the form of rain, snow, or other types of precipitation.
The hydrologic cycle is entirely powered by sun energy. The cycle is propelled by the sun's energy, which evaporates water from the Earth's water bodies and causes it to rise into the atmosphere as water vapor. Following the condensation of the water vapor into clouds, which are subsequently carried by the wind to various parts of the Earth, Precipitation, which can come in the forms of rain, snow, or sleet, is the final form in which the clouds release their water content. This water then replaces the seas, lakes, rivers, and other bodies of water on Earth, and the cycle repeats. The hydrologic cycle is primarily driven by solar energy and would not exist otherwise.
To know more about hydrologic cycle, visit:
https://brainly.com/question/1338837
#SPJ1
you are about to use a dissecting microscope. which of the following statements describes the best settings to begin with to find your specimen on the stage?
A dissecting microscope, with a maximum magnification of 100x, is used to examine larger specimens and three-dimensional objects.
This kind of microscope may be used to investigate structures that are difficult to mount onto flat slides or to study the exterior features of an object. The compound light microscope is used to view objects that cannot be seen with the eye, such as cells, or that require closer inspection, such as blood samples, whereas the dissecting microscope is more helpful when viewing objects with low magnification, such as organ tissues. A stereo or a dissecting lens makes use of the object's reflected light. It magnifies at low power, making it perfect for enhancing things that are opaque.
Learn more about microscope
https://brainly.com/question/6686502
#SPJ4
Energy storage molecule found in roots and seeds of plants Quickly accessed energy source Help protect vital organs Stored in fatty tissue; used for long-term energy storage Hydrophilic Insulation Hydrophobic Not a source of energy in organisms' diet Supplies organisms with energy if carbohydrates and fat are not available Wide range of functions: enzymes and signaling molecules Energy storage molecule found in muscles and the liver of animals Storage and processing of genetic information Carbohydrates Lipids Nucleic Acids Proteins
The three important sources of energy are carbohydrates, proteins, and fats. But nucleic acid helps in the transfer of genetic information.
Carbohydrates are considered the first source of energy for an organism. In animals, it is stored in the form of glycogen in muscle and liver. In plants, it is stored in the form of starch in its roots and seeds. They are hydrophilic because of the presence of OH groups and are quickly accessed for energy.
Lipids are hydrophobic molecules that play a major role in insulation from cold temperatures, act as long-term energy storage, protect vital organs, and are stored in fatty tissue called adipose tissue.
Nucleic acids are important for the transfer and processing of genetic information. They are hydrophilic because of phosphorus. Also, they do not act as an energy source.
Proteins can be both hydrophilic and hydrophobic based on their side chain. They also act as an energy source when fat and carbohydrates are unavailable. Some proteins are called enzymes and they also play a role in the signaling process. In plants, they are stored as an energy source in tubers, roots, and seeds.
To know more about carbohydrates:
https://brainly.com/question/29775112
#SPJ4
The complete question is -
Classify each of the following organic nutrients based on the descriptions provided. Answers may be used more than once.
the heart is located in the body cavities. dorsal, ventral, and pericardial thoracic, ventral and pleural ventral and thoracic ventral, thoracic and pericardial
The heart is located in the ventral, thoracic, and pericardial cavities of the body.
The ventral cavity is located on the front side of the body and contains several smaller cavities, including the thoracic and abdominal cavities. The thoracic cavity is located in the upper part of the ventral cavity and is surrounded by the ribcage. It contains the heart, lungs, and other important organs. The pericardial cavity is a small space within the thoracic cavity that surrounds the heart and contains a fluid-filled sac called the pericardium. The pleural cavity is also located within the thoracic cavity and surrounds the lungs. Overall, the heart is located in a complex system of interconnected cavities that work together to support the functioning of the body's vital organs.
Learn more about organs :
https://brainly.com/question/12825206
#SPJ4
what structure can the viral genome take? view available hint(s)for part a what structure can the viral genome take? ds-dna ss-dna ds-rna all of the listed responses are correct.
All of the listed responses are correct. (ds-DNA), (ss-RNA),and (ds-RNA).The genomes of all DNA viruses contain a single, double-stranded molecule which can be either linear or circular.
Chemical Composition and Method of Replication: A virus's genome is made up of DNA or RNA that can be single-stranded (ss), double-stranded (ds), linear, and circular. The whole genome may be contained within a single nucleic acid molecule (a monopartite genome) or several nucleic acid segments (multipartite genome). The genomes of all DNA viruses contain a single, double-stranded molecule which can be either linear or circular. The lone exception to this is parvoviruses. Circular DNA is a feature of both hepadnaviruses and papovaviruses. In a virus, a protein shell known as a capsid surrounds a single- or perhaps even double nucleic acid (DNA or RNA).
Learn more about genome
https://brainly.com/question/29482089
#SPJ4
complete the sentences to explain why the composition of the vapor is different from the composition of the solution.
The composition of the vapor is different from the composition of the solution because the vapor is the gaseous phase of a substance, while the solution is a homogeneous mixture of two or more substances
What is is a solution?A solution is a homogeneous mixture of two or more substances in which the particles of the solute are evenly distributed throughout the solvent. The solute is the substance that is dissolved in the solvent, and the solvent is the substance that the solute is dissolved in. In a solution, the solute dissolves in the solvent to form a uniform mixture. The properties of the solution are often different from those of the individual components, and the concentration of the solute can vary depending on the amount of solute that is dissolved.
learn about vapor pressure here https://brainly.com/question/2693029
#SPJ1
list as bullets with brief descriptions and in approximate chronological order the steps in the innate response to a bacterial infection. include both the cells and the molecules that are involved in the response to the bacteria and what each does
1. The innate immune responses can be summarized as below :
The conserved proteins as Toll like receptors on cells like neutrophils, dendritic cells and macrophages recognize pathogens’ PAMPs (lipopolysaccharide in Gram negative bacteria & peptidoglycan in Gram positive bacteria).Different fates of this recognition are Complement activation, Opsonization of bacteria, phagocytosis and inflammatory responses.Cytokines released can activates alternative and the lectin pathways of the complement system.The complement proteins bind to the surface of the bacterium as a membrane attack complex (MAC) to initiate complement-mediated lysisComplement activation may also lead to opsonization of the bacteria (marking bacteria for phagocytosis).This leads to phagocytosis of Opsonized bacteria by phagocytes like macrophages and neutrophils. Phagocytes destruct the bacteria using antimicrobial peptides and lysozymes. Opsonization kills Gram-positive bacteria which are usually resistant to killing by MAC.Activation of various receptors on macrophages and neutrophils recruit leukocytes to the site of infection.They initiate inflammatory responses.Learn more about innate immune
https://brainly.com/question/13553287
#SPJ4
Active transport is the process of
A. moving water through aquaporins.
B. moving substances down the concentration gradient.
C. assisting substances across the cell membrane with pores.
D. moving substances against the concentration gradient.
Active transport is the process of moving substances against the concentration gradient.
What are the four active modes of transportation?
A cell has four different types of transport mechanisms. There are four types of diffusion: simple diffusion, facilitated diffusion, primary active transport, and secondary active transport.
A protein pump uses energy in the form of ATP to move molecules from a low-concentration area to a high-concentration area during active transport.
Therefore, The sodium-potassium pump, which moves sodium ions to the outside of the cell and potassium ions to the inside, is an example of active transport.
Learn more about active transport from the given link.
https://brainly.com/question/29759743
#SPJ1
T/F a drop of liquid that does not evaporate from brown paper after a 20-minute period at room temperature contains lipids.
Answer: True
Explanation:
A drop of liquid that does not evaporate from the brown paper after a 20-minute period at room temperature contains lipids. True. Lipids evaporate at a much slower rate than polar substances such as water. In addition, they will have a shiny or greasy appearance on brown paper.
Jessica was involved in a serious car accident when she was 22 years old. She and her best friend Erin were driving on a slippery road when Jessica lost control of the car. The car hydroplaned, and flipped several times before landing on its top. Both Jessica and Erin survived the accident. Jessica received numerous physical injuries during the accident. Most of which she has recovered from, but she continues with speech therapy. Since her accident, Jessica has had difficulty expressing her speech. She is increasingly frustrated as she understands language expressed from others in both verbal and written form. But, she has difficulty speaking and also has difficulty expressing herself with written language
Jessica's left side of the brain appears to be the most impacted because she has trouble speaking clearly and expressing herself to others.
Which brains part is affected during an accident?Her frontal lobe on the left side of the brain, which is primarily responsible for forming the Broca speaking style in individuals, has suffered damage.
The frontal lobe of the brain appears to be damaged since it houses the Broca region, which is primarily affected whenever someone has speaking difficulties.
Therefore, the particular region of the brain that appears to be impacted is the Broca, which is entirely in charge of the creation of all human speech and experiences difficulties when injured.
Learn more about the brain, here:
https://brainly.com/question/15052297
#SPJ9
The given question is incomplete, so the most probable complete question is,
Jessica was involved in a serious car accident when she was 22 years old. She and her best friend Erin were driving on a slippery road when Jessica lost control of the car. The car hydroplaned and flipped several times before landing on its top. Both Jessica and Erin survived the accident. Jessica received numerous physical injuries during the accident. Most of which she has recovered from, but she continues with speech therapy. Since her accident, Jessica has had difficulty expressing her speech. She is increasingly frustrated as she understands language expressed by others in both verbal and written form. But, she has difficulty speaking and also has difficulty expressing herself with written language.
Which side of Jessica’s brain seems to be the most affected, right or left? Explain your answer.
b Which lobe of the brain seems to be affected?
c. What specific structure/area of the brain seems to be affected?
If one of the interacting systems has illness, how will this affect the systems' performance?
Answer:
Explanation:
The human body is comprised of a series of complex systems, including the skeletal system, the respiratory and digestive systems, as well as the intricate networks of blood and lymph vessels, all controlled by the brain and nervous system.during endocytosis volume decreases or increases
Answer:
decreases
Explanation:
the rates of endocytosis and exocytosis rise as quick compressions occur, but the changes in cell volume and membrane tension are reduced.