Which of the following is an optional part of a technological system?


output

input

feedback

process

Answers

Answer 1

Answer:

Feedback

Explanation:

A technological system is a system that consists of components constructed to work together in order to process an input to an output/result. These components or parts that make up a technological system are as follows: input, processing, output and feedback.

- The input is what is taken in by the system.

- The process is the series of occurrences conducted by the internal parts of the system to bring about an output.

- The output is the final result of the system.

- The feedback is how the system should work in comparison to how it is working.

Among all these parts of a technological system, the part that is OPTIONAL i.e the system can function without, is the FEEDBACK.


Related Questions

ASAP I WILL GIVE BRAINLYLISTSTSTS

Do you think that cell types with shorter or longer life spans go through mitosis more
often? Explain your answer.

Answers

Answer:

Shorter life spans

Explanation:

Everytime a cell dies, it needs to be replaced. Mitosis mainly occurs during cell growth/development, regeneration, or replacement.

cells with shorter lifespans probably go through mitosis more because since the lifespan is shorter the quicker it can go through mitosis and the more it would need to go through mitosis

Help!! ASAP!! What is asexual reproduction?

Answers

Answer:

Asexual reproduction is a type of reproduction that does not involve the fusion of gametes or change in the number of chromosomes. Many processes or methods are there to form new organism like binary fusion, budding, spore formation etc.

Explanation:

Binary fusion is one of the asexual reproduction. Example: Bacteria, Amoeba.

45,46,47
Please help

Answers

Answer:

66 55 and 34 welcome

Explanation:

good

ASAP The levels of water and salt in the blood are controlled by the ________, which is controlled by the ________.

Answers

Answer:

the hormone that regulates the salt and water levels is aldosterone found on the adrenal gland that sits above the kidney

Explanation:

Aldosterone, a hormone found in the adrenal gland above the kidney, regulates salt and water levels which are usually regulated by the renin-angiotensin system.

What is aldosterone?

Adrenal glands secrete aldosterone, a steroid hormone. Its primary function is to regulate salt and water in the body, thereby influencing blood pressure.

It is actually regulated by a system namely the renin-angiotensin system.

Thus, aldosterone, a hormone found in the adrenal gland above the kidney, regulates salt and water levels which are usually regulated by the renin-angiotensin system.

For more details regarding aldosterone, visit:

https://brainly.com/question/13971850

#SPJ2

Often, the second part of a scientific name is

Answers

“Ology” for example bi-ology. Ge-ology

Does an animal cell have a cell wall?

Answers

Answer:Plant cells have a cell wall, as well as a cell membrane. In plants, the cell wall surrounds the cell membrane. This gives the plant cell its unique rectangular shape. Animal cells simply have a cell membrane, but no cell wall

Explanation:

Answer:

No

Explanation:

Animal cells have cell membranes, but not cell walls. Cell walls are much more structured and are only present in plant cells who also have a cell membrane.

Which statement correctly describes the transfer of energy between the blue arrows?

There is no change in energy. There is twice the gain of energy. There is a loss of energy. There is a gain in energy.

Answers

There is a gain in energy

All living things must contain genetic material. Which of the following nonliving things also has this characteristic? A. Fire B. Cell phone C. Virus D. Organic phosphates

Answers

Genetic material is the hereditary unit found in the cells of every living organism. Viruses are nonliving things that also have genetic material. Thus, option C is correct.

What are viruses?

Viruses are organisms that are living and nonliving as they reproduce when once inside the host cell and have the RNA or the DNA as the genetic material inside their capsids.

The protein shell of the virus includes one of the types of genetic material that infects the host DNA by taking control of the host machine to produce multiple copies.

Therefore, the virus is a non-living with genetic material.

Learn more about viruses here:

https://brainly.com/question/9526388

#SPJ2

If a pure-bred tall plant is crossed with a pure-bred short plant, the offspring will be:

a. Either tall or short
b. All offspring will be medium sized.
c. Some offspring will be tall, some will be short and some will be medium sized.

Answers

I would say A. Either tall or short
When Mendel crossed purebred short plants with purebred tall plants, all of the offspring were TALL

The pure-bred tall plant dominated the short

Most single-celled organisms... *
have complex tissue
reproduce asexually
tissuescan be seen without a microscope

Answers

reproduce asexually

What will happen if external factors affect cell division in a group of cells placed in a culture dish

Answers

Answer:

The effect of an external physical factor on cell division is clearly seen in density-dependent inhibition, a phenomenon in which crowded cells stop dividing. ... When cells have formed a complete single layer, they stop dividing (density-dependent inhibition).

Explanation:

3. The Seventh Amendment protects
C. the right to bear arms
A. people from cruel and unusual punishment
B. the right to a jury in a civil case
D. people's houses from being searched
without a warrant

Answers

The answer to that is Answer “B”
The answer is B hope this helps

Which phrase best discribes how scientists use the data they collect

Answers

Answer: could you copy/paste or screenshot the phrase options? It'd really help me to answer your question.

Explanation:

When you eat an apple you are acting as a

Answers

Answer: Are their any answer choices for this question

Explanation:

What happens to the oxygen in respiration?

Answers

Explanation:

During aerobic cellular respiration, glucose reacts with oxygen, forming ATP that can be used by the cell. Carbon dioxide and water are created as byproducts. In cellular respiration, glucose and oxygen react to form ATP. Water and carbon dioxide are released as byproducts.

What features are seen in all cells?

Answers

All cells share four common components: (1) a plasma membrane, an outer covering that separates the cell’s interior from its surrounding environment; (2) cytoplasm, consisting of a jelly-like region within the cell in which other cellular components are found; (3) DNA, the genetic material of the cell; and (4) ribosomes, particles that synthesize proteins. However, prokaryotes differ from eukaryotic cells in several ways.

Answer:

cytoplasm, Cell membrane, and DNA and ribsome.

Please correct me If I am wrong Thank You

Explanation:

What will happen in the future to coral reefs if Greenhouse Gasses continue to rise?

Answers

Answer:

they will all die

Explanation:

Answer:

there will be global warming

Explanation:

because since the planet closest to the sun has greenhouse it must be hot on the planet but not on the outside

4 How many genetically different kinds of gametes an individual with genotype Aabb can
produce?
a)1
b)2
c) 4
d) 8​

Answers

Answer:

I believe the answer is C.) 4

Organisms stay the same due to evolution, natural selection and artificial selection. true or false​

Answers

Answer:

False

Explanation:

Answer:

false, plz dont take my answer down again for no reason

Explanation:

MARK AS BRAINLIEST Please answer this

Answers

Answer:

7 is A

8 is A

9 is also a

The cell membrane controls movement of materials into and out of the cell. The following particles are moving from high concentration to low concentration and are using a carrier protein. How would you describe this type of movement across the membrane?
A. simple osmosis

B. active transport

C. simple diffusion

D. facilitated diffusion and please give a reason why you chose this answer

Answers

Answer:

the answer woiuld be b

Explanation:

D. Dalmation Dogs may have either black or liver (brown) spots.
1. Two black-spotted Dalmation parents produce a liver-spotted puppy.
a. What does this tell us about dominance in spot color?
b. What is the genotype of the liver-spotted puppy?
c. What is the genotype of the mother? Of the father?
d. List the genotypes and phenotypes of all puppies these
parents could produce.
PLS HELP ASAP WILL GIVE POINTS AND HELPERS HAND

Answers

A: black spots are dominant
B: ss
C: both parents must be heterozygous to produce an offspring that expresses the recessive trait.
D: SS, Ss, and ss
Hope this helps!

critical thinking scientist can determine the age of a substance using a method that compares the amount of different forms of carbon atoms present in a substance. is this method more useful for organic substances or organic substances explain

Answers

Answer:

organic substances

Explanation:

define a warm front in your own words

Answers

Answer:

A warm front is an advancing edge of a warm air mass.

Explanation:

__________

Scientists insert a gene from a firefly into the genome of certain bacterial species. When these bacteria are placed into tobacco plants and exposed to certain conditions, the plants will glow. Tobacco plants without the bacteria do not glow. Which conclusion is best supported by this experiment?
A. The firefly and bacteria share a common genetic code.
B. The bacteria transferred light-producing proteins to the plant.
C. The firefly and tobacco plant have a recent common ancestor.
D. Tobacco plants lack the ability to translate the genetic code of firefly gene.

Answers

The answer is A.

A GENE is being inserted into the tobacco plant, which permits it to glow.

The conclusion that should be best supported by this experiment is option A.

Supported by the experiment?

At the time when the bacteria should be placed into the tobacco plants so here tobacco should be without the bacteria and this can't be glow. Also, the gene should be added into the tobacco plant moreover, the firefly and bacteria shared the common genetic code

Learn more about bacteria here: https://brainly.com/question/19520869

What is the answer for this?

Answers

The last one
The color change is to help hide from predators

Question 5
Which of the following is an autotroph?
Shark
Fish
Snail
Algae
Fungus

Answers

Algae is an autotroph. Autotrophs include organisms including plants, algae, plankton, and bacteria. Producers, primary consumers, secondary consumers, and tertiary consumers make up the food chain.

An autotroph is what?

An organism that can manufacture food by utilizing light, water, carbon dioxide, or other chemicals is known as an autotroph. Autotrophs are occasionally referred to as producers since they grow their nourishment. Although the most well-known autotroph is a plant, there are numerous more types of autotrophic creatures.

What exactly are heterotrophs and autotrophs?

Autotrophs are referred to as producers since they can generate their food using energy and raw resources. Plants, algae, and several varieties of bacteria are examples. Heterotrophs are known as consumers because they devour producers or other consumers. Humans, dogs, and birds are all instances of heterotrophs.

To know more about the autotroph visit:

https://brainly.com/question/30761655

#SPJ1

itś all in the link.

Answers

Answer:

Explanation:

The answer is C!

Hope it helps

A component of a circuit changes, as shown below. How would this change affect the electric circuit? A switch is closed, so the circuit would be incomplete and broken and the lights in the circuit would not shine. A switch is closed, so the circuit would be complete and unbroken and the lights in the circuit would shine. A switch is opened, so the circuit would be incomplete and broken and the lights in the circuit would not shine. A switch is opened, so the circuit would be complete and unbroken and the lights in the circuit would shine. Mark this and return Save and Exit

Answers

Answer:

A switch is closed, so the circuit would be complete and unbroken and the lights in the circuit would shine.

Explanation:

The image shows an open switch to a closed switch.

A closed switch represents a complete circuit, and an open switch represents an incomplete circuit. The lights would shine and the circuit would be complete because the switch is now closed.

The change affects the electric circuit as A switch is closed, so the circuit would be complete and unbroken and the lights in the circuit would shine. The correct option is B.

What is an electric circuit?

When an electric charge builds up inside of an object, it disperses across its surface and stays there until it can be discharged by an electrical current or electrical discharge; this is known as "static electricity."

From an open switch to a closed switch is shown in the image. An incomplete circuit is represented by an open switch, and a complete circuit is by a closed switch. The switch is now closed, so the lights would turn on and the circuit would be complete.

Therefore, the correct option is B. A switch is closed, so the circuit would be complete and unbroken and the lights in the circuit would shine.

To learn more about the electric circuit, refer to the below link:

https://brainly.com/question/29032441

#SPJ2

The question is incomplete. Your most probably complete question is given below:

The image is attached below

photosynthesis is composed of two main parts (light-dependent and light independent)these reaction occur in different structures of the chloroplast.what is the term that best describes light independent reaction and where does it occur
a) calvin cycle, stroma
b)photosystem 1, stroma
c) photosystem 2, thylakoid membranes
d) photosystem 1 and photosystem 2, thylakoid membranes

Answers

Answer:

the answer is A Calvin cycle stroma

Other Questions
El pepino se puso antejos.Es imposible que ______ antejos.PusoHaya puesto Se pusoSe haya puesto Which subject and verb are in agreement? A. Chefs/cooksB. Cars/drive C. Student/sitsD. Flowers/grow A tropical punch recipe calls for 300 ml of sugar for every 222 flavor packages. Write an equation that shows the relationship between s, the amount of sugar in milliliters, and f, the number of flavor packages for this recipe. The gustatory system is the sensory system that deals with smell. True or False Help please. Thank you. solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons. one of u guys helped me but they keep returning it saying show your work>:(