Which of the following matches is incorrect? *

Aphrodite = goddess of wisdom
Priam = king of Troy
Odysseus = king of Ithaca
Menelaus = king of Sparta

Answers

Answer 1
The answer would be Aphrodite, she's the goddess of beauty and sexual love.

Related Questions

where did the first struggle of the filipinos
taking place during the 1896 revolution

Pls answer ​

Answers

Answer:

On August 19, 1896, Katipunan was discovered by a Spanish friar, which resulted in the start of the Philippine Revolution. The revolution initially flared up in Central Luzon.

I need help , is important . :(((

Answers

Answer:B

Explanation:Becouse we can easily conclude its B becouse of bussnismen saying that

what explorer helped portugal win the european race for a sea route to asia?

Answers

Answer:

Vasco de Gama

Answer:

Vasco da Gama

Explanation:

Later, ​King Manuel​ of Portugal sent another explorer, ​Vasco da Gama​, on an expedition around the Cape of Good Hope. Da Gama left Lisbon, Portugal, in July 1497 and arrived in Southwestern India the next year Portugal had won the European race for a sea route to Asia.

What was the result of new innovations in the roaring 20s?

Answers

Answer: The Roaring 20s economy was not without its challenges. Business investors who were smart enough to make and sell the new innovations of the era were handsomely rewarded. As a result, income inequality rose to new levels. Also, the efficiencies brought by new machinery often meant fewer workers were needed in production.

Explanation: Give me the brainiest

The invasion of which country brought Britain (Canada) into far?
A)Serbia
B)Bosnia
C)France
D)Belgium

Answers

The invasion of Serbia by Austria Hungary

How are glycolysis and phosphagen systems used in both aerobic and anaerobic exercise?

Help please ill even date u

Answers

Answer:

lol no you wont I'm too Blonde and ugly

Explanation:

glycolysis breakes down sugar to give you energy and leaves the nasty lactic acid behind that kills your legs after a run. phosphagen systems also break down sugars to give you energy. both can continue to make energy without oxygen but perform better when oxygen is present.

what is an example of a country that makes use of another nation’s currency

Answers

El Salvador or Ecuador

What is nationalism?

A) Shame for past transgressions/ mistakes.
B) An agreement based on mutual benefit.
C) Irrational hatred toward a specific group of people.
D) Pride in one's country or people.

Answers

Answer:

D

Explanation:

Learned this in my class today, simply trust me.

BRAINLYEST!

The Cold War was "fought" by two sides known as the ___________, a term originally focused on Europe.

Answers

Answer:

the Soviet Union

Explanation:

Though the parties were technically at peace, the period was characterized by an aggressive arms race, proxy wars, and ideological bids for world dominance.

Europe aaaaaaaaaaaaaaa

How did the Allies deceive the Axis powers prior to the D-Day invasion?




I WILL MAKE BRAINLYEST PLEASE HELPP!!!!​

Answers

Answer:

Many tactics were used to carry out the deception, including fake equipment; a phantom army commanded by George Patton and supposedly based in England, across from Pas-de-Calais; double agents; and fraudulent radio transmissions.

Explanation:

Which of these was a result of the industrial revolution
a. A decrease in trade between countries
b. An increase in the population of cities
c. An equal distribution of ealth
d. A return to the feudal system

Answers

Answer:

could be b or c

Explanation:

I think it is B because of increased urbanization

Which statements accurately describe the Battle of Guadalcanal?

Answers

It was the first major Allied offensive in the Pacific.

It was fought completely at sea.

It ended in a draw.

It lasted six months.

It ended with Japan's defeat.

If I ask a question will I just be given THE answer?

Answers

yepp what’s your question i might can help

In your opinion, do you believe the
Crusades were
justified? Why? Explain
your answer in at least 2 complete
sentences.

Answers

Answer:

No, the Crusades weren’t justifiable. The Arab/Muslim conquest of the region centuries earlier wasn’t justifiable either. There were no good guys or bad guys in that conflict. Both sides were wrong.

From the perspective of Jews and Samaritans, it was really just two colonial powers (Crusaders and Arabs) fighting over a land that never rightfully belonged to either of them in the first place.

Explanation:

What is important today is to understand that the unjustified reaction of the Christian community to actions in the Holy Land can be compared to the reaction of people in the Muslim world to Western dominance. So, instead of something like the Crusades was seen as an acceptance by many Muslims of terrorism. If the Christian Crusades were bad, so is the Muslim acceptance for decades of terrorism, particularly towards Israeli civilians.

What was the significance of the Ten Commandments to the ancient Hebrews?

A.
It marked the beginning of the Exodus as the people were freed from Egypt.
B.
It created a set of religious laws and beliefs for the people to follow.
C.
It showed that Moses was the leader who they were supposed to follow.
D.
It told the people to travel back to Canaan, the land God had promised them.

Answers

Answer:

I believe it's C.

Explanation:

The ten commandments are religious laws, they never mention or imply any of those other options

What message does this 1969
poster from the Environmental
Protection Agency give about the
government's role in pollution?

Answers

That the government is protecting the air we breath. This was to show that government did infact care about the environment but that was and still is a lie!

The message conveyed by his 1969 Environmental Protection Agency poster about the government's role in pollution is that the government has it under control and is concerned about the environment. The word "product" attributes the "clean air" to the government.

What is pollution?

Pollution is the introduction of harmful contaminants into the natural environment. Pollution can be any substance (solid, liquid, or gas) or energy.

The Environmental Protection Agency (EPA) is a federal executive agency of the United States tasked with environmental protection. The Environmental Protection Agency protects people and the environment from significant health risks by funding and conducting research, as well as developing and enforcing environmental regulations.

Therefore, the poster is stating that government's active participation to remove pollution and give people clean air.

To learn more about pollution, click here:

https://brainly.com/question/28519286

#SPJ6

HELP QUICK. Use the following image to answer the question

In this chart which section represents a trail court at state level?
B
A
F
E

Answers

Answer:

try a or b I don't know if I'm right

Which conelusion is best supported by the map?
A) The Gobi Desert is located in southem China
B) Many mineral resources are located along the East China Sea The least populated areas in China are found in the north and west. D) Beijing is one of China's busiest seaports.​

Answers

Answer:

C) The least populated areas in China are found in the north and west.

Explanation:

The question asks for the conclusion best supported by the map.

A) The Gobi Desert is located in southern China

According to the map, we see the Gobi Desert to the north of China. The map cannot prove this statement.

B) Many mineral resources are located along the East China Sea

First of all, this map shows us the populations of China. Because of that, we are unable to decide whether or not many mineral resources are located along East China Sea.

C) The least populated areas in China are found in the north and west.

As stated above, this map shows the populations in China. The areas found in China on this map are colored grayish-white. According to the map key, this tells is that there are only 0-2 or 0-5 people per km in the area. This means that the least populated areas in China are in fact found in the north and west, making this statement true.

D) Beijing is one of China's busiest seaports.​

We see Beijing different than all other cities mentioned in the map. The map key, however, informs us that it means Beijing is the capitol of China. It does not mean Beijing is China's busiest seaports.

Help! WILL MARK BRAINLIEST
Farmers were able to grow enough food for their families, and they were able to __________extra food to different areas. When settlers grew crops to be sold for money, they were called___________. This was an economic advantage for this region.

Answers


Farmers were able to grow enough food for their families, and they were able to TRANSPORT extra food to different areas. When settlers grew crops to be sold for money, they were called CASH CROPS. This was an economic advantage for this region.

i think this is right

What was one thing that all Reconstruction plans had in common?
a. To control and restrict southern states
b. To give Freedmen the right to vote
c. To restore the United States of America
d. To punish former Confederates

Answers

Answer:

c

Explanation:

renuify the north and south after wars end

Casas —- are not part of the original jurisdiction of the U.S Supreme Court

Answers

Answer:

wat r u askin nerd

Explanation:

nativists reacted to immigration in the late 1800s by:

Answers

Answer:

Nativists reacted badly to immigration, they were against it and wanted to limit the number of immigrants coming into the US. What were conditions like in the tenements? ... Conditions ere very poor in the tenements they were unhealthy and sometimes dangerous. How was education improved in the late 1800s?

Explanation: Hope that this helps you.

Nativists opposed immigration and wanted to limit the number of immigrants coming into the United States.

What is immigration in the late 1800s ?

Between 1870 and 1900, the majority of immigrants came from northern and western Europe, including the United Kingdom, Ireland, and Scandinavia. However, "new" immigrants from southern and eastern Europe were quickly becoming one of the most powerful forces in American society.

Emigrants frequently settled in the New England states, with Boston and other Massachusetts cities having the highest concentrations. The number of New foundlanders and Labradorians living in Massachusetts increased from 2,851 to 10,583 between 1885 and 1905.

Crop failure, job shortages, and tax increases were the three challenges faced by immigrants who arrived in the United States in the late 1800s.Crop Failure: Frequent crop failures eventually led to famine. Many people died of starvation. The immigrants thought the United States was a prosperous and wealthy country.

Learn more about immigration  here

https://brainly.com/question/22842908

#SPJ5

What was the name of the great Falcon God who in the beginning, gave the Pharaohs their power?

Answers

Horus gave the pharaohs their power
Horus, Egyptian Hor, Har, Her, or Heru, in ancient Egyptian religion, a god in the form of a falcon whose right eye was the sun or morning star, representing power and quintessence, and whose left eye was the moon or evening star, representing healing.

Why was it easy for Jane to move around while she was exploring

Answers

Answer:

Jane Eyre takes place in five settings: Gateshead Hall, Lowood School, Thornfield Hall, Moor House, and Ferndean. Each setting encompasses a different stage in Jane’s life. Gateshead, where the Reeds live and Jane spends her young childhood days, contains the terrifying red-room, the place in which she undergoes her first truly terrifying experience: a supposed encounter with her Uncle Reed’s ghost. Jane’s marked change from this encounter prompts Mrs. Reed to send her to Lowood School, a place filled with similarly oppressive circumstances. Brontë modeled the harsh conditions of Lowood School after an English school she attended with her sisters. Just like in the novel, students suffered from typhus and consumption. Scholars note that Mr. Brocklehurst’s doctrine of privation matches Evangelical doctrines popular in Victorian England, and many read this section as a critique of those branches of Protestantism. After Lowood, Jane moves on to Rochester’s Thornfield Hall, which has a frightening, ominous presence at night, and Brontë uses quite a few other Gothic elements, such as descriptions of the supernatural, to define the setting. Many Gothic novels explore anxieties around sexuality, and accordingly Thornfield is where Jane explores romantic passion with Rochester. Moor House and Ferndean have less developed physical significance, but important names. The word “moor” signifies a mooring, a place where something is docked. Moor House is where Jane receives her inheritance, granting her stability for once in her life. The “fern” in Ferndean symbolizes the new growth Jane and Rochester will experience there, and Jane confirms that she has spent the past ten blissful years there by Rochester’s side, as his wife and his equal.

What teaching style is identified with Socrates, and what was it like

Answers

What teaching style is identified with Socrates, and what was it like? The teaching style was the question and answer style also known as the Socratic method. This teaching style was good for the young people because it taught them to think about things harder.

Hoped that helped:)

This map shows the location of a landform that was created millions of years ago. It is a deep trench that is nearly 4,000 miles long. Which landform is shaded on the map?

Answers

Based on the map given, it can be deduced that the landform is the Great Rift Valley.

A landform simply means a natural physical feature of the surface of the Earth that's defined by its forms and location.

From the map, the Great Rift Valley is illustrated. It is a series of contiguous geographic trenches, that is approximately 7,000 kilometres in total length.

Learn more about landforms on:

https://brainly.com/question/3881291

The Bill of Rights ensures that all U.S. citizens:
A. will have the right to travel freely between states.
B. will be treated equally regardless of their gender.
C. will receive a jury trial if accused of a crime.
O D. will be able to choose which taxes to pay.

Answers

The correct answer is C

Answer:C. Will receive a jury trail of accused of a crime.

Explanation:

What would the world be like without books?

Answers

I don't know I don't know I don't k ow

I feel like the world would be pretty uneducated

according to plato rational thought was necessary

Answers

Answer:

Explanation:

no

How did territorial expansion increase tensions over slavery in the United States

Answers

Answer:

Becuase of the issue of more slave or free states.  If one Slave State outnumbered the  Free states would get most of the vote on something. That Free states may not want.

With the new states/land being in the issue of the balance of free states and slave states.

Other Questions
Please help due tomorrow Giving Brainlesst What happened In world war SOLVE HYPOTENUSE LEG-HL-GEOMETRY What is the main idea of Hayess statement?A. He will let the South govern as it wishes.B. He will only look out for Northern interests.C. He will work to unite the interests of North and South.D. He thinks that the division between North and South is important.I think the Answer is "C". 1 2 3 4 5 6 7 8 9 10TIME REMAINING55:47A bill can be either __________, meaning that its contents and the discussion surrounding it are open to anyone, or __________, meaning that most discussions about the bill take place behind closed doors and are not widely known.A.censored . . . openB.hidden . . . privateC.public . . . privateD.public . . . exposedPlease select the best answer from the choices providedABCDMark this and return (If you don't know, don't answer)How can I solve them?1. 44=t722. 18+z=403.18(f)=914. 57=y25. 14=d+(10) In the convention of 1818 what did the U.S obtain from this treaty ?? AC current is produced by which of the following things? A. Remotes B. Generators C. Lights D. Lasers What is the area of a room that is 3 3/4 yards long by 3 1/3 yards wide? In which situation would a photographer most likely use butterfly, or paramount, lighting?landscape photographywildlife photographyaction photographyfashion photography 1 less then the quotent of a number n and 6 Draw the Lewis structures forCalcium bromide, CaBr2 What did farmers want the government to regulate in the late 1800's?1. Steel mills2. Unions3. Railroads4. Banks AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA Order the angles in the triangle above from largest to smallest.Largest1.B2.D3.Smallest Does technology always follow the science,yes or no explain why to choice A body of laws and rules defining the relationship between the government and the people is called:the pacta constitutiona judiciarya treaty Source 1 Pitts' Flash Mob Robberies articleTopic sentence 1 What does this article show about mob mentality? how to factorize 5x^2-20y^2 Sam runs 6 miles in 55 minutes. At the same rate, how many miles would he run in 44 minutes?