Which of the following statements is true about mutations?
A. It is a source of genetic variation
B. Rates tend to be very high in most populations.
C. It is generally lethal
D.It affects only somatic cells

Answers

Answer 1

Answer:

A. It is a source of genetic variation

Answer 2
It is a source of genetic variation

Related Questions

How does natural selection lead to the evolution of a species?

Answers

Answer:

One of these is natural selection, which is a process that increases the frequency of advantageous gene variants, called alleles, in a population. Natural selection can result in organisms that are more likely to survive and reproduce and may eventually lead to speciation.

Explanation:

When a species evolves, it can get more repellent and tougher to what kills them off. For exp, if a animal can’t survive due to a carried disease, it will eventually evolve to be stronger against it.

Type a paragraph describing how the circulatory and respiratory systems work together to deliver oxygen to the body’s tissues and remove carbon dioxide.
i. Include the names of structures and other components that play a role in gas
exchange.
ii. Explain how the interactions between the circulatory and respiratory systems
contribute to maintaining homeostasis in the body.
b) Type a second paragraph comparing the accuracy of your model to actual organ systems and
their functions.
i. Consider how a model is different from an actual human body.
ii. Describe the limitations of a model

Answers

Answer:

The circulatory and respiratory systems work together to circulate blood and oxygen throughout the body. Air moves in and out of the lungs through the trachea, bronchi, and bronchioles. Blood moves in and out of the lungs through the pulmonary arteries and veins that connect to the heart.

The circulatory and respiratory system work together to provide oxygen and remove carbondioxide gas.

How circulatory and respiratory system work together?

The circulatory and respiratory systems work together to circulate blood and oxygen throughout the body. Air moves in to bring oxygen and out of the lungs to remove carbondioxde gas from the body. Blood moves into the lungs to bring carbondioxide gas and to load oxygen with the help of pumping of heart.

So we can conclude that circulatory and respiratory system work together to provide oxygen and remove carbondioxide gas.

Learn more about system here: https://brainly.com/question/14323743

Plzz help
Determine the proper number of chromosomes that would be found in a human cell at each stage of the cell cycle.

Answers

Answer:  The genetic material of the cell is duplicated during S phase of interphase just as it was with mitosis resulting in 46 chromosomes and 92 chromatids during Prophase I and Metaphase I. However, these chromosomes are not arranged in the same way as they were during mitosis.

Explanation:

SCIENCE ASSAP PLS
what does secondary succession mean in science

Answers

secondary succession is when plants and animals recolonize a habitat after a major ecological disturbance

Why do we want to produce genetically different organisms?

Answers

Answer: Genetically engineered crops produce higher yields, have a longer shelf life, are resistant to diseases and pests, and even taste better.

Explanation:

Everything I think produce organs I think

why is this conversion of energy from one molecule to another necessary for all cells?

Answers

[tex]\mathfrak{\huge{\orange{\underline{\underline{AnSwEr:-}}}}}[/tex]

Actually Welcome to the Concept of the energy conversion

=> ATP can be used to store energy for future reactions or be withdrawn to pay for reactions when energy is required by the cell.

=> When one phosphate group is removed by breaking a phosphoanhydride bond in a process called hydrolysis, energy is released, and ATP is converted to adenosine diphosphate (ADP).

Which function of the integumentary system is illustrated in the release of sweat?
Absorbtion
Protection
Sensory Reception
Regulation
Secretion
Both regulation and secretion

Answers

Answer:

Secretion

Explanation:

Not completely sure tho, good luck

Which of the following is an advantage of meiosis and sexual reproduction?
A. Meiosis ensures that offspring will not inherit any genetic disorders.
B. Meiosis ensures that offspring are genetically identical as their parents.
C. Meiosis ensures that offspring will have identical phenotypes to their parents.
D. Meiosis ensures a wider variety of genetic variation.

Answers

Answer:

D. Meiosis ensures a wider variety of genetic variation.

This happens above all thanks to the Crossing over, the process in which the exchange of genetic material during sexual reproduction between two homologous chromosomes' non-sister chromatids results in recombinant chromosomes.

2. Write the complementary DNA strand: (1 points)
CTT GAC TGA TGC

Answers

GAA CTG ACT ACG is the answer
GAA CTG ACT ACG
pretty sure this is right

What is the meaning of the term metabolism?

Answers

Metabolism is the chemical processes that occur within a living organism in order to maintain life. Have a good day! Also, any answer that says, ‘Here is the link to your answer: (link)’ DO NOT CLICK ON IT!!

1 point
The type of cellular transport shown in the image (to the right) is called

Endocytosis
Exocytosis
Osmosis
Diffusion

Answers

Answer:

Exocytosis

Explanation:

Exocytosis is when a bulk of molecules exit the cell. The arrows indicate that it is leaving the cell.

Answer:

B. Exocytosis

Explanation:

Exocytosis is the process by which vesicles in the cytoplasm fuse with the cell membrane, releasing their contents into the cell's external environment. Cellular wastes are often disposed through this process.

What are the two most common sources for rivers and streams?

Answers

Answer:The source of a river or stream may be a lake, a marsh, a spring, glacier, or a collection of headwaters. The furthest stream is called the headstream. Headwaters are small streams that create the river or stream and may be cool waters, because of shade and barely melted ice or rain.

Explanation:I did this in class 2 days ago LOL

Answer:

The source of a river or stream may be a lake, a marsh, a spring, glacier, or a collection of headwaters. The furthest stream is called the headstream. Headwaters are small streams that create the river or stream and may be cool waters, because of shade and barely melted ice or rain.

Explanation:

Hope this helped you :D

Santos and Lüderitz are the same distance from the equator, and both cities are near the ocean. The air temperature in Lüderitz is colder than the air temperature in Santos. What causes the air temperature in these places to be different? Explain what causes the difference as completely as you can.

Answers

Answer:

The Ocean Currents.

Explanation:

if you look at a current map, you'll see warm currents near Sanots and cold ones near Lüderitz. Therefore, the air in Sanots is a lot warmer and the air in Lüderitz is colder.

The phenomenon of the ocean current is responsible for this deviation of air temperature between two places.

What do you mean by Air temperature?

Air temperature may be defined as the temperature of the surrounding air of organisms including humans.

The ocean water captures the heat from the sunlight and increases the temperature of the ocean. This heat is then entranced through ocean circulation and increases the temperature of the air as well as the atmosphere.

The air temperature in Luderitz is colder because the ocean of this region receives less sunlight in low intensity which results in less heat captured by the ocean and makes the air a little bit colder than that of Santos oceans.

Therefore, it is well described above.

To learn more about Ocean currents, refer to the link:

https://brainly.com/question/1145641

#SPJ2

A student examines a periodic table.
Which inferences about sodium (Na) are true?

Answers

Answer:

true c this is the answer

The Moon completes one orbit around the Earth in approximately
in approximately
and completes one cycle of its phases
A 271/3 days, 24 hours
B 24 hours, 24 hours
C 24 hours, 29 1/2 days
D 27 1/3 days, 29 1/2 days

Answers

Answer:

Answer is D

Explanation:

Takes about then to circle the Earth

Answer:

It takes 27 days, 7 hours, and 43 minutes

Explanation:

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Answers

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

scientific and common name for this?

Answers

Answer:

The common name for this is Moss

Scientific name is Bryophyta

Explanation:

Which of the following is true about the role of genetic and environmental factors in human health?
A) Genes are the only factor affecting whether or not an idividual will contract a disease.
B) Genetic factors are more important than environmental factors in determining an individual's
personal health risks.
C) Individuals can influence their health by controlling their genetic traits.
D) Environmental factors determine whether or not all genetic traits lead to health issues.
E) Certain environments can lead to an increased risk of developing certain diseases.

Answers

Answer:

E) Certain environments can lead to an increased risk of developing certain diseases.

Explanation:

The lesson states that specific environments can increase the chance of health problems.

list the planets from smallest to largest

Answers

Answer:

Mercury, Mars, Venus, Earth, Neptune, Uranus, Saturn, and Jupiter

Explanation:

Answer:

Mercury, Mars, Venus, Earth, Neptune, Uranus, Saturn, and Jupiter.

Explanation:

hope this helps!!!:)

2. How are humans making greenhouse gases of our own?
burning fossil fuels in our cars
burning forests
O all of these

Answers

Answer:

All of them. Plus feeding cows corn instead of grass makes them gassy.

Explanation:

A plant produces seed cones and pollen cones . Is it vascular? To what group of plants does it belong

Answers

A plant produces seed cones and pollen cones. Belong to plant group
phylum Coniferophyta and Yes it is vascular

A plant that produces seed cones and pollen cones is a vascular plant, and plants that produce seed cones and pollen cones belong to the group of plants known as gymnosperms.

What are gymnosperms?

Gymnosperms are a group of seed plants that produce seeds that are not enclosed in an ovary and produce open seeds that are usually borne in cones and include a variety of plant species, including conifers such as pine, spruce, and fir trees, cycads such as palm-like plants, ginkgoes, etc., and the production of seed cones and pollen cones is a vital characteristic of gymnosperms, these seed cones, which are also called female cones, produce seeds that are typically larger and more complex than pollen grains.

Hence, a plant that produces seed cones and pollen cones is a vascular plant and belongs to the group of plants known as gymnosperms.

Find out more about gymnosperms here.

https://brainly.com/question/15158870

#SPJ2

AHHHH PLS HELPP Which method is better for the environment: the controlled burn (burning oil off of the water) or using the naturally-occuring bacteria?

Answers

Answer:

using the naturally_occuring bacteria

Explanation:

go trying and helping wich with

What percentage of Americans use solar power ?

Answers

Answer:

66.7 percent.

Explanation:

I looked it up and nothing rly said what percentage of Americans use solar power but solar power was used for 2.30% of the total US electricity.

White blood cells ingest, then digest, a number of bacteria and other pathogens. White blood cells would require high numbers of which organelle in order to function properly?

Answers

Answer:

Lysosome

Explanation:

Why do we care how strong a rock is?

Answers

Answer:

hahahahahahahaha

Explanation:

because

Answer:

to throw it at ur cheating bf

Explanation:

lma.o

  °   •  .°•    ✯

   ★ *     °      °·                            

.   • ° ★ •  ☄

▁▂▃▄▅▆▇▇▆▅▄▃▁▂

During cellular respiration, energy is transferred from *
1 point
A. ATP to glucose
B. CO2 to enzymes
c. sunlight to glucose
D. glucose to ATP

Answers

Answer:

a or b I'm sorry but I know it's not c

Answer:

A? im not sure..................

What happens to chromosomes when an ovum and a sperm meet at fertilisation

Answers

Answer: When egg and sperm cells combine in fertilizations, they merge the two sets of chromosomes, ending up with 46 chromosomes in total. The maternal chromosomes from the egg cell and the paternal chromosomes from the sperm cell pair up. The resultant cell is called a zygote. Fertilization happens when a sperm cell successfully meets an egg cell in the fallopian tube. Once fertilization takes place, this newly fertilized cell is called a zygote. From here, the zygote will move down the fallopian tube and into the uterus. The zygote then burrows into the uterus lining.

Explanation:

If there are 60 crayfish living in a pond that is 20 cubic yards, what is the population density?

Answers

Answer:

80

Explanation:

I NEEEED HEEELP PLZZZZZZZZ :))

Answers

They would have black and white because grey shows up as lavender or blue in a chicken and it can’t be black or white because it says BW that is together so it would have to be black and white

Answer:

They would have both black and white feathers because codominance means that both genotypes have to be expressed. Gray isn't an apparent (given) trait.

what happens to most solar radiation when it gets to earth??

Answers

Answer:

Most of the solar radiation is bounced off of earth´s atmosphere.

Explanation:

Due to earth´s magnetic field, we are able to be protected from most of the solar radiation the sun emits.

Other Questions
What is the relationship between the two quantities in the table? Please help! Will give Brainleist!!!1. Record the appropriate question in French for the response provided below. Use est-ce que. Oui, il est franais.Thanks! PLSSS HELP ASAPIdentify all the forms of figurative language from the poem below!!Drum on your drums, batter on your banjoes,sob on the long cool winding saxophones.Go to it, jazzmen.Sling your knuckles on the bottoms of the happytin pans, let your trombones ooze, and go husha-husha-hush with the slippery sand-paper.Moan like an autumn wind high in the lonesome treetops,moan soft like you wanted somebody terrible, cry like aracing car slipping away from a motorcycle cop,bang-bang! you jazzmen, bang altogether drums, traps,banjoes, horns, tin cans-make two people fight on thetop of a stairway and scratch each other's eyes in aclinch' tumbling down the stairs.Can2 the rough stuff... now a Mississippi steamboatpushes up the night river with a hoo-hoo-hoo-oo ... andthe green lanterns calling to the high soft stars ... a redmoon rides on the humps of the low river hills ... go to it,O jazzmen. 2. Which of the following represent the value n, if theexpression below is rewritten in the form 3"?3^-4 x 3^10A) n = -40B) n=6C) n= -6D) n=14 Why are DNA fingerprints are more reliable than hand fingerprints in solving crimes. y5x=3 solve for y please WHAT LITERARY DEVICE IS BEING USED?? PLEASE HELP ASAPPNew York state is one of only two in the U.S. that automatically arrests and tries 16- to 17-year-olds as adults. a- Rosa Parksb- Medgar Evansc- Ella Barkerd- Thurgood Marshall ( PLEASE HELP ASAP ILL GIVE BRAINLIEST) is this right ? if not please help me !ILL GIVE BRAINLIEST *EXTRA POINTS*.. IM GIVING 40 POINTS !! DONT SKIP :((. -4x=16 what is x in the equation Suppose an EPA chemist tests a 250.mL sample of groundwater known to be contaminated with nickel(II) chloride, which would react with silver nitrate solution like this: NiCl2(aq) + 2AgNO3(aq) 2AgCl(s) + NiNO32(aq) The chemist adds 15.0mM silver nitrate solution to the sample until silver chloride stops forming. He then washes, dries, and weighs the precipitate. He finds he has collected 5.8mg of silver chloride. Calculate the concentration of nickel(II) chloride contaminant in the original groundwater sample. Round your answer to 2 significant digits. Solve this equation:3 (5x + 2) - 7 (3x - 4) = (5 - 9x) 2I need step by step explanation with details.Thank you! A wave with a frequency of 325 Hz. is travelling at a speed of 125 m/s. What is the wavelength of this wave? Subtract: (b^2 + 9 ab + 5a ) - ( 3b^2 -25ab + 1) How can a change in structure to an organisms' cell negatively effect that organism? Follooww me on iiii---nnnn---sss--tttt--aa---ggg--rrr--aaa---mmm-i-n--s-t-a-g-r--a==mStewart.lil2----- HELPA company sells widgets. The amount of profit, y, made by the company, is related tothe selling price of each widget, x, by the given equation. Using this equation, find outthe maximum amount of profit the company can make, to the nearest dollar.y= -2x^2 + 105x 859 Which has a higher temperature: a snowman or a lit match?Group of answer choiceslit matchsnowmanNo answer text provided. Help 7TH GRADE math I give out good rating and BRAINIEST! pls help asap giving out brainliest and high stars