Which of the following statements is/are true with regard to a polymer of 6 glucose molecules?

I. The chemical formula is C36H72O36

II. The chemical formula is C36H62O31

III. The monomers of glucose were joined via hydrolysis

IV. The monomers of glucose were joined via dehydration synthesis

Answers

Answer 1

Answer:

Statement 'IV' is correct

Explanation:

Glucose molecules are joined together through condenstation/ dehydration (loss of water) reactions.

Answer 2

The statement that is true with regard to a polymer of 6 glucose molecules is as follows:

The monomers of glucose were joined via dehydration synthesis.

Thus, the correct option for this question is D.

What is Glucose?

Glucose may be defined as a type of simple sugar known as monosaccharides. It bears a chemical formula [tex]C_6H_1_2O_6[/tex]. It is considered the main type of sugar in the blood and is the major source of energy for the body's cells.

Dehydration synthesis involves the reaction between two or more molecules of glucose with the continuous liberation or loss of water molecules. The chemical formula of glucose remains the same when there are six or more polymers that take place, the chemical formula never changes.

Therefore, the correct option for this question is D.

To learn more about Glucose, refer to the link:

https://brainly.com/question/3380149

#SPJ2


Related Questions

when a piece of zucchini is soaked in salt water, the zucchini loses its firmness. Which process best explains what happens to the zucchini?

Answers

Explanation:

The zucchini is breaking down which we already know bit the zuchinni is absorbing and breaking down at the same time so when that happens the cells are expanding and breaking

think of a water balloon

Answer:

The cells in the zucchini shrink because they lose their water.

Explanation:

explain conservation of matter in nature

Answers

Answer:

Conservation of matter in nature is that things cannot be magically created or destroyed.

Explanation:

Compare how both prokaryotes and eukaryotes use two of the cell
structures listed and describe the common functions of these structures

Answers

Answer:

I don't know I'm sorry

Explanation:

I don't remember but if you search it up it will give you the answer.

How does a enzyme work?
Using these words
“Speeding up the.... by lowering the...”

Answers

Like all catalysts, enzymes work by lowering the activation energy of chemical reactions.

A cell placed in a high salt solution would swell because of osmosis.
A. True
B. False

Answers

Answer:

false

Explanation:

False

explanation :

shrink

Hope this helps

can anyone please tell why the bell jar is covered with black cloth in test for carbon dioxide ?​

Answers

Answer:

To test

Explanation:

test

When a plant drinks water the water has enters

Atmosphere
biosphere
geosphere
hydrosphere

Answers

Answer:

geosphere

Explanation:

What are examples of Geosphere?

It includes everything natural and lifeless that make up the surface of the earth. Examples are all the rocks and sand particles from dry land to those found at the bottom of the oceans. They also include the mountains, minerals, lava and molten magma from beneath the earth's crust.

Answer:

B. biosphere

Explanation:

The water that was in the hydrosphere has entered the roots of a plant and the plant is in the bioshere.

Given the sequence ATGGCGAATCACGTCACTTGA
a) Write the sequence of nucleotides for the complementary strand of DNA.
b) Write the mRNA sequence transcribed from the complementary strand.
c) What is the tRNA sequence that would be used to translate this sequence?
d) Convert the message into an amino acid sequence.

Answers

Answer:

a. TACG

b.UAC CGC UUA GUG CAG UGA ACU

c.ATCG

d.ser-arg-leu-val-ser-stop-thr

Explanation:

What is NOT a reason hydrogen bonds are significant?

Question 1 options:

Many molecules can have hydrogen bonding occur between them


They are extremely strong compared to ionic or covalent bonds


They are the reason for many of water's amazing properties



They are present in very common molecules found on Earth


Example of adhesion is when water sticks to _______ and cohesion is when water sticks to __________

Question 2 options:

Different molecules or surfaces, other WATER molecules


Solids, liquids


Liquids, Solids


Other WATER molecules, different molecules or surfaces

Hydrophilic substances, such as phosphate groups ___________

Question 3 options:

Fear and run away from water


Will not dissolve in water


Are attracted to hydrogen and other gases


Love to be surrounded by water

Which statement is NOT true?

Question 5 options:

Many sugars are not organic molecules


Sugar is used for a variety of purposes other than energy


Wood and paper are almost entirely sugar


Polysaccharides are carbohydrates

Answers

Answer:1.  not as strong as ionic or covalent bonds. 2. Adhesion is when water sticks to other things, not water; cohesion is when similar molecules stick together. 3. Hydrophilic means liking water. 5. polysaccharides are carbohydrates

Explanation: self explanatory

The characteristic of a cell membrane that allows materials to pass troughs it is called ?

A.synthesis
B.polarity
C.permeability
D.catalysis

Answers

Answer:

It's permeability

Explanation:

Describe the levels of organization of a human being

Answers

Answer:

wassup ExTrA

Explanation:

Life processes of the human body are maintained at several levels of structural organization. These include the chemical, cellular, tissue, organ, organ system, and the organism level. Higher levels of organization are built from lower levels.

hope this helps

function of typosole

Answers

In earthworms, it is a dorsal flap of the intestine that runs along most of its length, effectively forming a tube within a tube, and increasing the absorption area by that of its inner surface. Its function is to increase intestine surface area for more efficient absorption of digested nutrients

I WILL GIVE 100 POINTS!!
You have learned that heat moves from warm areas to cooler ones. In solids, heat is transferred by the physical touching of molecules. This type of heat transfer is called conduction. Some materials, like metal, conduct heat better than other materials. In fluids (liquids and gases), heat is transferred by convection currents caused by differences in density.

MATERIALS
hot water
cold water
metal fork
plastic fork
stick of cold butter
large glass
watch or clock with a second hand
yellow and blue food coloring
playing card
four empty, identical plastic bottles (sports drink bottles work well)
access to a sink

QUESTIONS
Part 1
What type of heat transfer is demonstrated in Part 1?
How long did it take for the butter to melt off of the plastic fork? The metal fork?
How do explain the difference in time between the two forks?
Part 2
What type of heat transfer is demonstrated in Part 2?
What happened when the warm water bottle was placed over the cold water bottle? Why?
What happened when the cold water bottle was placed over the warm water bottle? Why?

Answers

Pt. 1

In gases and liquids, heat is usually transferred by convection, in which the motion of the gas or liquid itself carries heat from one place to another. ... If you boil water in a kettle, the heat is transferred through convection from the fire to the pot.

Pt. 2

This motion of fluids is called convection. In the set of bottles where the hot water was above the cold water, the cold water was already on the bottom, so there was no convection.

Pt. 3

When the bottle was put into the cold water, the air in the bottle contracted, taking up a smaller space in the bottle. The sides of the bottle pushed in when the air inside controlled

Which natural hazard is least likely to affect Florida?
A drought
B wildfire
C rip current
D tsunami

Answers

Answer:

c I think I'm taking the test atm

Explanation:

Answer:

d

Explanation:

quizlet

Which of the following is used to bind the bricks of the wall?


a) glass b) wool c) cement d) steel

Answers

C- Cement. firstly , the other options would never work. Secondly, cement acts as a glue for bricks

Q.which bird don't make its own nest?​

Answers

The common cuckoo does not make a nest of its own, and they do not bring up their own young. Instead, the female lays her eggs in the nests of other birds. Each female cuckoo specialises in just one host species, and lays camouflaged eggs in that bird's nest.

Exam
What do we call information you've
gathered, whether through
experimentation or research?
A. hypothesis
B. data
C. conclusion
D. procedures

Answers

Answer: Data

Definition: Data means facts and statistics collected together for reference or analysis.

Let me know if this helps you!

please help! I really need help!

Answers

Hi!
For the first one 50% will have brown fur (Bb) while the other 50% will have white fur (bb)

The second one will be 100% hard shells because that combo will produce 4 heterozygous combos (Hh)

And finally the last will be 75% large beaks, 25% small

What are two major surfaces on the moon? Which is younger?

Answers

The two major surfaces of the moon are the maria and the highlands. The maria would be younger, since it has less craters than the highlands.

Hope this helps!

which of the following do not contribute to the decaying process
a. sunlight b. microorganism. c. sound. water

Answers

The answer is C—sound

Polarity of bonds and molecules is determined by the of atoms involved.

Answers

Answer:

Bond polarity is determined by the difference in electronegativity and is defined as the relative ability of an atom to attract electrons when present in a compound.

Explanation: :))

electronegativity

Explanation:

usa test prep

What are the approximate coordinates of the star Rigel?

Answers

Answer:

approximately 860 light-years (260 pc) from Earth

temperature of water in morning

Answers

Preferably, take a cup of warm water in the morning, to stimulate the movement of the intestine, as hot water helps to relax the blood vessels and the digestive tract and thus stimulate digestion. Taking a cup of lukewarm water keeps the body balanced and promotes the body's persistence by applying all its functions
Warm water helps the body

what force dose dark energy have on the universe?

Answers

The rest of the universe appears to be made of a mysterious, invisible substance called dark matter (25 percent) and a force that repels gravity known as dark energy (70 percent).

Juanita and Alfred hypothesize that a seed will sprout faster if it is warmer. They plant three seeds and water them the same amount. One seed is placed near a heater, one is left at room temperature, and one in a refrigerator. The results are shown in the table below. Do the results support the hypothesis?

Temperature of Seed Days to Sprout
by heater 2 days
room temperature 5 days
in refrigerator did not sprout
A.
No, because the seeds all sprouted at the same time.
B.
Yes, because the cooler seeds sprouted sooner.
C.
Yes, because the warmer seeds sprouted sooner.
D.
No, because the cooler seeds sprouted sooner.

Answers

Answer:

C

Explanation:

Yes, because the warmer seeds sprouted sooner.

Yes, because the warmer seeds sprouted sooner.

What is Room temperature?

The typical temperature range in a home is widely agreed to be between 68 and 76 degrees Fahrenheit, specific variations and geographic variations aside.

The use of smart home appliances, such as a smart AC controller, automates the maintenance of these typical house temperatures at all times, however keeping the ideal room temperature is a challenge.

The location, season, type of house, and personal preferences are just a few of the many variables that can dramatically affect the appropriate room temperature. When determining appropriate room temperatures, home architecture is a crucial factor.

Therefore, Yes, because the warmer seeds sprouted sooner.

To learn more about Warmer seeds, refer to the link:

https://brainly.com/question/7589654

#SPJ2

if humans didn't exist what would the world be right now and the life on it ​

Answers

Answer:

"Effectively, there used to be large animals everywhere, and there would be large animals everywhere around the globe without human involvement." His research has revealed that without humanity's heavy species impact, the central United States, and parts of South America,

Explanation:

NPR. Imagining a World Without Humans What would happen to the Earth if all humans suddenly disappeared? In his new book, The World Without Us, author Alan Weisman discusses how long it would take for all evidence of human life to vanish from the planet.

10 Species That Would Dominate if Humans Died Out

The Rats. Rats love disasters. ...

The Bears. Humans are unquestionably masters of the planet. ...

The Dogs. If you've ever been to a developing nation, you know that dogs are already in charge of large swathes of the planet. ...

The Ants. ...

The Pigs. ...

The Octopi. ...

The Racoons. ...

The Cockroaches.

1. In the 1820s what did scientists think all dinosaurs really were


Answers

Answer:

yes dinosaurs were there

Explanation:

some fossils and skeleton models were found as proof

Use a Punnett's squares to show a monohybrid cross between pure breeding parents of tall (T) and dwarf (t) pea plants.
The tall trait is dominant and thus is represented by the uppercase letter "T". The dwarf trait is recessive and is represented by
to lowercase letter "t".

Answers

Answer/Explanation:

True breeding means the parents have two copies of the same allele (two of the same letter)

That means the monohybrid cross is TT x tt

      T            T

t      Tt          Tt

t      Tt          Tt

All the offspring have one copy of each and are Tt. Tall is dominant to dwa rf. So all the offspring will be tall.

which human activity negatively affects the stability of the enviroment

Answers

Answer:

pesticides

Explanation:

damages soil and plants

What are the properties of Oxygen Chalcogens and what is it used for?

Answers

The properties of Oxygen Chalcogens are, oxygen, sulfur, selenium, tellurium and polonium. It is used to make acids, sulfuric acids, nitric acids, and other compounds.
Other Questions
Given the figure below find the values of x and z. helpppppppppppppppppppppppppppppp Suppose that during the past 3 years, equilibrium real GDP in a country rose steadily, from $ billion to $ billion, but even though the position of its aggregate demand curve remained unchanged, its equilibrium price level steadily declined, from to . What could have accounted for these outcomes, and what is the term for the change in the price level experienced by this country? A. Economic growth without an increase in aggregate demand; secular deflation. B. Recession with inflation; stagflation. C. Economic growth with an increase in aggregate demand; secular deflation. D. Increase in aggregate demand without economic growth: disinflation. Can someone pls help me solve this? I just dont get it, please help please k(x) = 6x 12; k(x) = 18 Which of the following mountain ranges is located on the East Coast of the United States? Tell me the story from the eyes of the antagonist What is the factored form of the polynomal? x2-12x+27o (x+4)(x+3)o (x-4)(x+3)o (x+9)(x+3) o (x-9)(x-3) Mr. Tonroy hired Michael to make balloon animals for the children who visited a carnival. Michael was paid a base fee of $100.00 plus a fee of $1.50 per balloon animal made. If Michael was paid $295.00, how many balloon animals did Michael make? Which of the following is an example of chemical weathering?A. Splitting of rick due to expansion of waterB. Shrinkage of rock when the water is evaporatedC. Erosion due to wind-blown sandD. Cave formation from the acid in water dissolving limestone PLEASE HURRY IM TIMEDDuring the process of demographic transition, why does the total population continue to grow if the natural increaserate is moderating?O The crude birthrate stabilizes while the crude death rate declines.O The crude birthrate remains higher than the crude death rateO The crude birthrate declines faster than the crude death rateO Economic changes stabilize the crude death rate.O Economic changes stabilize the crude birthrate Ice melts in yourglass of water. What method of heat transfer causes this? On Monday, Jayla raised $ 30 and Carlos raised $ 50. After that, Jayla raised $ 12 per day and Carlos raised $ 7 per day. After how many days will they have raised the same amount? They will raise the same amount after days. (Only type in the number for your final answer) write down the group numbers for carbon,oxygen,nitrogen and sulphur Which is an example of an effective study skill? Simone applied the distributive property using the greatest common factor to determine the expression that is equivalent to 24 + 56. Her work is shown below. Factors of 24: 1, 2, 3, 4, 6, 8, 12, 24 Factors of 56: 1, 2, 4, 7, 8, 14, 28, 56 24 + 56 = 8 (4 + 7) What statement best describes Simone's error? Why does a hypothesis have to be written in a way where it can be falsified? The Mazzanti Wholesale Food Company's fiscal year-end is June 30. The company issues quarterly financial statements requiring the company to prepare adjusting entries at the end of each quarter. Assuming all quarterly adjusting entries were properly recorded, prepare the necessary year-end adjusting entries at the end of June 30, 2016, for the following situations. a. On December 1, 2020, the company paid its annual fire insurance premium of $6,800 for the year beginning December 1 and debited prepaid insurance. b. On August 31, 2020, the company borrowed $107,500 from a local bank. The note requires principal and interest at 8% to be paid on August 31, 2021. c. Mazzanti owns a warehouse that it rents to another company. On January 1, 2021, Mazzanti collected $25,600 representing rent for the 2021 calendar year and credited deferred rent revenue. d. Depreciation on the office building is $18,600 for the fiscal year. e. Employee salaries for the month of June 2021 $19,000 will be paid on July 20, 2021. Scientific knowledge builds upon previous knowledge."Which situation does NOT illustrate this statement?A) Theodor Schwann using his knowledge about plant cells and experimenting to see if the same was true about animal cells. B) Becquerel's accidental discovery of radiation when photographic plates were inadvertently left near a radioactive rock. C) Robert Hooke using the Galileo's microscope to help create a compound microscope which is stronger and better that Galileo's. D) Matthias Schleiden taking the knowledge gained by Robert Brown about the nucleus of the cell to develop a new thought about the role of the nucleus in cell development. Georgians were divided in the issues of the Revolutionary War. Why was the colony reluctant to join the revolution at first?A.Georgia had a long, successful history of self-governmentB.Georgia was self-sufficient and did not depend on Great BritainC.Georgia was financially dependent on Great BritainD.Georgia had not objections to the Intolerable Acts