Answer:
I think the answer is c
Explanation:
LOTS OF POINTS!?!?!The amount of CO2 coming out of volcanoes is less than Type Here% of what goes into the atmosphere from burning fossil fuels.
FILL IN THE TYPE HERE PART!?!?!?!
Which of the following pairs of organisms belong to the same population?
A. a dog and a cat
B. a marigold and a geranium
C. a human mother and her child
D. a spider and a cockroach
B. would be the answer.
I hope this helps
A pair of human mother and her child belongs to the same population.
What is population?"Individuals of any species live in groups in a well defined geographical area, share or complete for similar resources, potentially interbreed and thus constitute a population."A dog and a cat, a marigold and a geranium and a spider and a cockroach do not share similar resources and they don't interbreed so they do not belong to the same population.
Hence, the correct option is C. a human mother and her child.
To know more about population here
https://brainly.com/question/16138725
#SPJ2
Q1.
The process of Transcription is involved in the ?
(a) Conversation of RNA & DNA
(6) Movement of RNA from nucleus
(c) Formation of RNA & DNA
(d) None of these
Answer:
Transcription is DNA -> RNA
Explanation:
Transcription is DNA to RNA
Translation is RNA-> Proteins
(4pts) Drugs, medicines, and poisons often work by acting on endogenous proteins. They do this by looking similar to a signal molecule and binding to the endogenous protein. Look up these four examples to fill in this chart. Drug, medicine, or poison Looks similar to this endogenous molecule: Binds to this endogenous protein/receptor: Muscarine Acetylcholine muscarinic receptors Prozac Serotonin serotonin transporter protein Ketamine NMDA NMDA receptor Tamoxifen estrogen estrogen receptor
Answer:
Drug, medicine, or poison: Muscarine; Looks similar to this endogenous molecule: Acetylcholine; Binds to this endogenous protein/receptor: muscarinic receptors
Drug, medicine, or poison: Tamoxifen; Looks similar to this endogenous molecule: estrogen; Binds to this endogenous protein/receptor: estrogen receptor
Drug, medicine, or poison: Prozac; Looks similar to this endogenous molecule: Serotonin; Binds to this endogenous protein/receptor: serotonin transporter protein
Drug, medicine, or poison: Ketamine; Looks similar to this endogenous molecule: NMDA; Binds to this endogenous protein/receptor: NMDA receptor
Explanation:
Muscarine is a poisonous natural product found in certain mushrooms. It is similar to acetylcholine and competes with acetylcholine at its receptor binding sites.Signs of muscarine poisoning include salivation, lacrimation, vomiting, diarrhea, abdominal pain, bradycardia, etc.
Tamoxifen is a selective estrogen receptor modulator. It is similar to estrogen and acts by inhibiting the effects of estrogen in the breast tissue. It is used to prevent and treat breast cancer in men and women.
Prozac is an antidepressant which belongs to th class known as selective serotonin reuptake inhibitors. It looks similar to serotonin and inhibits its action by competing with serotonin for its binding site. It is used for the treatment of depression disorders.
Ketamine is an NMDA (N-Methyl-D-aspartate) receptor antagonist. NMDA receptor antagonists are a class of drugs that work by inhibiting the action of the NMDA receptor. They are commonly used as anesthetics for animals and humans to induce a state of anesthesia known as dissociative anesthesia.
Write a paragraph about the symbiotic association between algae and fungi
Answer:
if you need the answer then follow
Explanation:
me and I swear I will send the answer after you follow me
Activity #1
Normal DNA Sequence
DNA:
TACCCCGTGCAT ATAT CATATAGCACT
mRNA:
Protein:
Mutated DNA Sequence
DNA:
TACCCCGTGCACATATCGTATAGCACT
mRNA:
Protein:
Describe the effects of the change(s) in the mutated DNA sequence. Did the protein change? Do you think
this protein can perform its normal function?
Stephanie Elkowitz
Help please!!!!
for the normal DNA sequence, since thymine (T) binds with adenine(A) and Adenine(A) binds with uracil(U) because there is no thymine is RNA guanine(G) pairs with cytosine(C) :
normal DNA:TACCCCGTGCAT ATAT CATATAGCACT
normal mRNA:AUG GGG CAC GUA UAU AGU- AUA UCG UGA
i grouped letters in threes as codons
normal Protein:methionine-glycine-histidine-valine-Tyrosine-Serine-Isoleucine-serine-stop
mutated DNA:TACCCCGTGCACATATCGTATAGCACT
mutated mRNA:AUG GGG CAC GUG UAU AGC AUA UCG UGA
mutated protein:methionine-glycine-histidine-leucine-Tyrosine-Serine-Isoleucine-Serine-stop
In the mutated protein valine is replaced with leucine. Those two amino acids have different radicals that perform different functions so the protein will have an altered function.
What substances are combined with sunlight in the process of photosynthesis?
A. carbon dioxide and water
B. water and simple sugar
C. carbon dioxide and oxygen
D. oxygen and simple sugar
Answer:
D is the answer
Explanation:
check it out
Explain the interaction with another body system.
Answer:
Body systems are used throughout your body to help you move and to live like the heart for example.
a hypothesis for exercise 2 might state "if the five substances are distinct, then they will have unique characteristics that distinguish them from one another." Was this hypothesis supported or disproved?
How do plate tectonics support evolution?
cellular respiration allows organisms to release
Answer:
energy // ATP
Explanation:
A solution with a lower solute concentration in comparison to Solution
Answer:
Hypotonic
Explanation:
When you are comparing solutions with unequal solute concentrations, the solution with a higher solute concentration is a hypertonic, while the one with a lower one is a hypotonic. If they are equal, then they are isotonic.
what is Acetyl-coA and how does it help with food digestion ?
Answer: what is Acetyl CoA is made from pyruvate under aerobic conditions in the mitochondria. The process of conversion is irreversible. I don't know the other half I'm sorry.
Explanation:
Acetyl CoA Used by the citric acid cycle as a fuel. Carbon acetyl groups are converted to CO2 and ATP and electrons (carried by NADH and FADH2) create even MORE electrons. Acetyl CoA is made from pyruvate under aerobic conditions in the mitochondria. The Process of conversion is irreversible.
(PLEASE HURRY)Strong winds blow sand to a new location, and some of the sand forms a sand dune. The first plant species to live in the new habitat of the sand dune is a type of grass. This grass stabilizes the sand dune. Over time, the sand dune grows larger and soil forms on the surface. As these changes occur, different plant species become dominant.
Why doesn't the original grass remain the dominant plant on the sand dune?
A.
The grass cannot reproduce fast enough to cover all of the growing dune.
B.
New plants are better suited to the new conditions in the sand dune habitat.
C.
The grass moves to new sand dunes to start the succession process again.
D.
New animals come to the new sand dune habitat and eat the grass.
An plant only requires the correct chemicals to make plant food
Why do most of the marine species live at or near the surface of the ocean
Answer:
Most marine organisms live within the sunlit surface waters. Strong sunlight supports photosynthesis by marine algae. Algae either directly or indirectly provide food for the majority of organisms. ... Most marine animals also live near the surface because this is where they can find food.
Explanation:
Brainliest please?
What is the manipulated variable in this experiment?
O A. The distance the snails moved
OB. The size of the petri dishes
C. The temperature of the water
D. The number of snails observed HELP ME
The correct answer is C. The temperature of the water
Explanation:
In an experiment such as the one described about the speed of snails in water, the manipulated variable is the factor or element that is manipulated on purpose. This means the researcher or researchers slightly change this element to compare how this affects another variable. In this context, the manipulated variable is the temperature of the water because researchers used three different temperatures (cool, room-temperature, and warm), and therefore they manipulated or changed this factor. Moreover, it is expected temperature affects the distance nails move, which is the main variable.
Below are models of two types of cells. Which of the following structures are common to both cell types?
A. mitochondria and vacuoles
B. mitochondria and cell wall
C. vacuoles and chloroplasts
D. cell wall and chloroplasts
Answer:
A.mitochondria and vacuoles
Explanation:
The one on the left is the animal cell and the one on the right is the plant cell.
Both of these contain mitochondria and vacuoles(are larger in plant cells).
HURRY I NEED HELP QUICKLY. As part of an adventure challenge, you find yourself dropped into a unknown place. There are birds and wolves. The air is cold, and the ground is very hard. What biome have you landed in? Explain.
Answer:
You have landed in a tundra.
Explanation:
Birds as in penguins
Wolves as in Arctic wolves/foxes
The ground is hard because it is frozen
The air is cold
Please help. What safeguards are in place to protect Americans from unsafe food? Are these methods science-based?
Answer: The FDA and USDA cerate food safety programs, safeguards to protect Americans, to protect people from unsafe food. The FDA has monitoring programs for pathogens, naturaltoxins, pesticides, etc.; their methods are science-based.
The safeguards that are placed to protect Americans from unsafe food are FDA and USDA. FDA means food and drug administrator and USDA means U.S. department of agriculture.
What are FDA and USDA?FDA stands for food and drug administrator. It is a health and food department to ensure public health and to check the food items that the citizens are consuming.
USDA stands for The United States Department of Agriculture. The department is responsible for making the laws regarding food quality, and they also develop new qualities of fruits and vegetables.
These departments are based on scientific research and methods. Many scientists work under this to save people from having bad food.
Thus, The FDA and USDA are the safeguards set up to protect Americans from tainted food.
To learn more about FDA and USDA, refer to the below link:
https://brainly.com/question/21469257
#SPJ2
Describe three roles of lipids
Answer:
-storing energy
-chemical messengers
-structure
Explanation:
how is the cell able to make the many different proteins it needs? In your answer, be sure to: identify where in the cell the information necessary to make a particular protein is located and the specific molecule that contains this information AND identify both the cellular structure that makes these proteins and the kinds of molecules that are used as the building blocks of the protein
Answer:
Explanation:
Most genes contain the information needed to make functional molecules called proteins. (A few genes produce other molecules that help the cell assemble proteins.) The journey from gene to protein is complex and tightly controlled within each cell.
Select the best answers from the drop-down menus.
regulate organ function.
control voluntary muscle movements.
control involuntary muscle movements.
Answer:
voluntary muscle movements
Answer: general visceral nerves
Somatic nerves
Special visceral nerves
Explanation:
An experiment is designed to compare the effects of glucose and sucrose on the osmoticpotential of a model cell. Two dialysis bags are used, one filled with a solution of 5% by massglucose and the other with a 5% by mass sucrose solution. A given membrane is permeable towater but impermeable to glucose and sucrose. Each membrane bag is then placed in a beaker ofdistilled water for two hours. The change in mass of the glucose bag is recorded below.Solution (5% by mass) Initial Mass ofSolution andMembrane Bag (g) Final Mass of Solutionand Membrane Bag(g)Glucose in DistilledWater 10.0 13.2Sucrose in DistilledWater 10.0 ?I got this question incorrect because I said the glucose would pass through the semipermeablemembrane, however, it would be the water that passes through. One way I can prevent myself.
Answer:
i dont understand you're qiestion
Glucose can pass through the semi permeable membranes where the molecules can pass because they are soluble in water enough. The molecules can pass through because of the solubility factors.
What is a semi permeable membrane ?It is the semi permeable membrane where the half of the molecules get passed through the membrane. The molecules are selectively present.
Cell membranes are an example of semi-permeable membranes. Cell membranes allow small molecules such as oxygen, water carbon dioxide and glucose to pass through, but do not allow larger molecules like sucrose, proteins and starch to enter the cell directly.
Transport is helped by certain molecules as well where the few of the ions, channels and the molecules are taken up by the membrane through the selected transportation of the ions.
Learn more about selectively permeable membrane at :
https://brainly.com/question/11635962
#SPJ5
PLEASE HURRY,(GIVING BRAINLIEST) (THE ACTUAL SUBJECT IS SCIENCE)After a major forest fire kills all of the plants in an area, the first plants to grow in the burned area are often types of grass. Because they are the first thing to grow in the new ecosystem, these types of grass are called pioneer species. What adaptations would help the grass be a successful pioneer species?
A.
slow reproduction and the ability to grow in sunny places
B.
rapid reproduction and the ability to grow in sunny places
C.
slow reproduction and the ability to grow in shady places
D.
rapid reproduction and the ability to grow in shady places
Answer: B
Explanation:
To help the pioneer species to grow, it needs to have rapid reproduction. But, it also needs the sun to grow very well. If it does not have the Sun, it will most certainly die and be endangered in the area. The answer is B, we need both rapid reproduction and the Sun.
Answer:
rapid reproduction and the ability to grow in sunny places
Explanation:
After a major fire, less sunlight is blocked by trees and other plants. Plants that can use the increased sunlight are more likely to thrive in the new environment. Rapid reproduction would help a plant species to spread more quickly to take advantage of the resources and lack of competition. Therefore, the adaptations that would help grass be a successful pioneer species are rapid reproduction and the ability to grow in sunny places.
URGENT!
__________ fabric wrinkles less than ____________ fabric.
Linen, synthetic
Jute, Synthetic
Cotton, synthetic
Synthetic, cotton
Answer:
Synthetic, cotton
Explanation:
Synthetic fabric wrinkles less than cotton fabric.
Wrinkle is known to be an unusual fold, ridge or crease in the cloth. Some cloth experience this type of wrinkle why some do not. The material of the cloth determines its ability to wrinkle. Synthetics are known to be more wrinkle resistant than cotton and even linens. 100% linen or a blend of cotton/linen. Even polyester clothes are more wrinkle resistant than cotton.
Study this image. PLEASEE HELPP WILL GIVE BRAINLYEST
Which statement correctly explains what is happening?
A. Oceanic and continental plates are colliding.
B. Oceanic and continental plates are shifting past each other.
C. Two continental plates are forming a large mountain.
D. Two oceanic plates are creating several island chains.
Answer:
its B
Explanation:
becuse When oceanic or continental plates slide past each other in opposite directions, or move in the same direction but at different speeds, a transform fault boundary is formed. No new crust is created or subducted, and no volcanoes form, but earthquakes occur along the fault.
Which of the following is an example of technology we currently add to people's bodies? O A Computer brain OB Electronic lungs OC Internal heaters D. Prosthetic leg
Answer:D. Prothetic leg
Explanation:
All the other answer choices are still dreamt of by many scientists and engineers. but you always see people wearing prosthetic legs. D is the obvious answer.
Which of the following is not characteristic of a behavior?
Answer:
list
Explanation:
Answer:
exicted
Explanation:
Which statement did Virchow's work add to the cell theory?
A. Cells contain genetic material that consists of DNA.
O B. The cell is the basic structural and functional unit of life.
O C. All living things are made of one or more cells.
O D. All cells come from other living cells.
Answer:
D
Explanation:
The German doctor Rudolf Virchow proposed that all cells result from the division of previously existing cells, and this idea became a key piece of modern cell theory.
This results from cytokinesis when he observes cells splitting into two.
please give thanks by clicking the heart button! :)