Which organelle aids in the production and movement of proteins and other materials through the cell?Which accurately labels the lysosome?

Answers

Answer 1

Answer:

Hey

Explanation:

✴Endoplasmic Reticulum organelle aids in the production and movement of proteins and other materials through the cell.


Related Questions

When an organism dies, carbon dioxide can still be transported out of its nerve cells, but calcium
ions cannot. Suggest the reason for this difference.

Answers

Answer:Oxygen availability is often a limiting factor for cell survival, and it is generally ... An organism is faced with the following problem: How can the composition of ISF be ... which ensures proper exchange of oxygen and carbon dioxide; the kidney, ... to carry out its function of bringing blood close to cells so that the exchange of ...

by RN Pittman · ‎2011 · ‎Cited by 54 · ‎Related articles

Explanation:

Macronutrients and Micronutrients: Mastery Test An individual with a protein deficiency typically experiences increased susceptibility to illnesses, muscle and joint pain, and diffic concentrating. Why does a protein deficiency cause such diverse symptoms? А. because the only role of proteins is to provide the enzymes that all cells need to function B. because proteins are the primary Reset Next​

Answers

Answer:

its B option  90% of our body is made up of protien so deficiency of protiens causes serious problems.

Explanation:

After concluding his research, which statements would Virchow agree with? CHECK ALL THAT APPLY.

Living things come from nonliving things.

Cells can come from nonliving materials.

Frogs can come from mud.

Living things can only come from living things.

Cells come from pre-existing cells.

Answers

Answer:

Living things can only come from living things.

Cells come from pre-existing cells.

Explanation:

Rudolf Virchow a german physicist, biologist and many more, In 1855 Vproposed that cells come from pre-existing based on his observations in exact words 'Omnis cellula e cellula', which translates into all cells arise from pre-existing cells.

He also said the living things come from living things and do not arise from nonliving things or matter. His discoveries made possible the cell theory

State a technology and
explain how it is used to
forecast a future event.

Answers

Explanation:

I don't really know your question but I will tell you what can be predicted.

But how can a technological forecast be made to contain probability dimensions in the same way other forecasts do? Most people think of a technology as a quite specific physical entity. They do not conceive of this entity as having the variable characteristics which would permit range forecasts or probability statements. To their minds, a precisely defined technology either will exist in a given situation, or it will not. And the forecaster must predict this exact event or else he is wrong. This misconception—which would place an impossible demand on any forecaster causes much of the confusion in discussions about technological forecasting.

Posted by;

Ehie, BenjiDev#3339.

Weather forecast would be a technology to determine weather in the future. We would be able to know the humidity and wether or not it’s raining or snowing. So we can dress accordingly and be ready for anything that comes our way. Also the forecast be used to determine bad storms such as a tornado or hurricane. We’ll be notified so we can get to safety or evacuate.

Identify the statement that is true about Charles Darwin's theory of evolution by natural selection. Choose one: A. In each new generation, those that survive and those that don't are determined randomly. B. Organisms that are able to survive and reproduce pass on characteristics to their offspring. C. Populations of organisms continuously increase over time. D. As environments change, individual organisms choose to change to better suit the new environment.

Answers

Answer: Option B.

Organisms that are able to survive and reproduce pass on characteristics to their offspring

Explanation:

Charles Darwin theory of natural selection states that organisms possesses heritable traits that they developed and are able to survive, reproduce and adapt to their environment and they pass those traits to their generations. It is a differential survival mechanism.organisms that are able to survive and reproduce pass on the heritable characteristics to their offsprings and produce more organisms.

The statement that is true about Charles Darwin's theory of evolution by natural selection is option "B" which is Organisms that are able to survive and reproduce pass on characteristics to their offspring.

What is Charles Darwin's theory of evolution?

Charles Darwin's theory of evolution is also known as darwin's theory.

It is said that evolution occurs by natural selection. Individuals in a species show divergence in physical features. This divergence is because of dissimilarities in their genes.

Thus, option "B" is Organisms that are able to survive and reproduce pass on characteristics to their offspring.

To learn more about Charles Darwin's theory click here:

https://brainly.com/question/8153375

Which of the following best describes the role of water in photosynthesis?

Answers

Answer: During the process of photosynthesis, six molecules of carbon dioxide and six molecules of water react in the presence of sunlight to form one glucose molecule and six molecules of oxygen. The role of water is to release oxygen (O) from the water molecule into the atmosphere in the form of oxygen gas (O2).

Explanation:

The question is incomplete, the options is gotten from another website.

Here are the options.

Water Is the only source ofprotons for the formatlon of & proton gradlent Water molecules donate elecirons to the electron transport chaln: Water molecules combine wlth stored carbon molecules t0 produce glucose Water Is the terminal electron acceptor for electrons that pass through the electron transport chain;

Water molecules combine wlth stored carbon molecules to produce glucose best describe the Role of water

What is Photosynthesis?

Photosynthesis is the process where gree plants uses light energy from sun with carbon dioxide to produce glucose and water in the presence of chlorophyll.

What is the Role of water in Photosynthesis?

Six molecules of water react with six molecules of carbon molecules to produce glucose.

It form chemical potential around membrane which help in the production of energy.

Therefore, Water molecules combine wlth stored carbon molecules to produce glucose best describe the Role of water.

Learn more on Photosynthesis from the link below.

https://brainly.com/question/3529377.

Predict the nature of the indicated covalent
bond.
H
H-C-N

H
H
H
polar
non-polar

Answers

Answer:

The nature of the indicated covalent bond is polar.

Explanation:

The given diagram is the Lewis structure of Methylamine which has the formula, CH₃NH₂.

In order to know that it is polar, we will discover that in the Lewis structure there are unpaired electrons in the central atom. Also, the bond that exists between the hydrogen and nitrogen shows that it is polar.

CH₃NH₂ is seen to have two charged ends that are opposite and the bonds that exists between hydrogen and nitrogen, which makes it a polar molecule.

The electronegativities of carbon, hydrogen and nitrogen can also be used to determine its polarity.

PLEASE HELP ME❤️ Explain the ways waves interact with other waves

Answers

Answer: Waves interact with matter in several ways. The interactions occur when waves pass from one medium to another. The types of interactions are reflection, refraction, and diffraction. Each type of interaction is described in detail below.

Explanation: be me friend on brainlly

Schizophrenia:
A. cannot be treated.
B. cannot be cured but can be treated.
C. can be cured with treatment.
D. is very common.
SUE

Answers

Answer:

B

Explanation:

cannot be cured but can be treated.

Which process do all organisms do when performing cellular respiration?

Answers

Answer:

Glycolysis

Explanation:

Glycolysis is the first step of cellular respiration, where glucose is turned into 2 pyruvate molecules.

This step happens in all living organisms, since it does not require oxygen and also occurs in the cytoplasm, which all cells have.

So, glycolysis is the process that all organisms do during cellular respiration.

What is a pollinator?
an animal that transfers pollen from flower to flower
a colorful flower that attracts insects
an insect that makes pollen
a flower that produces fruit for animals to eat

Answers

Explanation:

an animal that transfers pollen from flower to flower

hope it helps!

An animal that transfers pollen from flower to flower

these types of leaves have one main vein called the midrib , and smaller branching vein

stomate

crenate

lobed

parted

Answers

The leaf has 2 types of venation the parallel venation and reticulate venation.

All of the veins, the petiole, and the midrib help position the blade so that it is facing the light source.

State the 4 agents most
responsible for land mass
movement

Answers

Answer: soil sun water and fertilizer

Explanation:

Answer: erosion, weathering, earthquake?, plate tectonics

Explanation:

6. An adult male red fox weighs 8 kg (kilograms). In order to maintain his
weight and survive, he needs to intake 59 Kcal/kg of body weight per day.
This means he needs to consume 59 Kcal for every one kg of his body
weight.
How do we determine the number of Kcal per day for the fox?

Answers

Answer:

472kcal

Explanation:

You multiply the number of calories with the number of kilograms.

59*8=472kcal

5. On vacation at a lake, Saira's mom sees an interesting-looking rock formation. Saira just learned
about rocks in geology class and tells her mom that the formation is made of gneiss, a type of
metamorphic rock. How did this metamorphic rock form?

Answers

Answer:it was heated and under pressure

Explanation:

Metamorphic rocks are formed from existing rocks, under high temperature and high pressure. This process is called metamorphism.

What is a metamorphic rock?

Metamorphic rocks are those rocks that are formed from different kinds of rock like igneous, sedimentary, or gneiss rock under high pressure and intense temperature. They are rigid in nature.

In the formation of metamorphic rocks, firstly existing rock is broken down into small particles by physical, chemical, or biological agents. The process of breaking down rock is called weathering.  Then erosion and transportation of these particles take place by the wind, water, or any biological agent.

The next step involves compaction after sedimentation. Thus, metamorphic rocks are formed from existing rocks.

Learn more about metamorphic rocks, here:

https://brainly.com/question/2615484

#SPJ5

why does ligments stretch when pulled by bone​

Answers

They can stretch because there is one fluid present between ligament called synovial fluid!

Help ASAP
thanks...............

Answers

1. Aurora
2. Ion
3. Thermosphere
4. Troposphere
5. Stratosphere
6. Ionosphere
7. Mesosphere
8. Ozone
9. Ozonosphere

Answer:

1. Ozone :- Form of oxygen having three atoms of oxygen to a molecule.

2. Mesosphere :- Later of the atmosphere just above the stratosphere.

3. Stratosphere :- The layer of atmosphere just above the troposphere where the temperature remains fairly constant.

4. Thermosphere :- The layer of atmosphere above the mesosphere where temperature are the highest in the atmosphere.

5. Ozonosphere :- Region in the upper stratosphere where the ozone is concentrated.

6. Aurora :- Streamers and band of light appearing in the sky at night , especially in polar region.

7. Ionosphere :- Layer of atmosphere containing ions; above the stratosphere.

8. Ion :- An electrically charged atoms.

9. Troposphere :- The layer of the atmosphere nearest the Earth in which most weather changes occur.

Which material would get electrons from the source to the load the fastest

Answers

Answer:

However, graphene has far fewer electrons than copper, so in graphene the electrical current is carried by only a few electrons moving much faster than the electrons in copper." In semiconductors, a different measure, mobility, is used to quantify how fast electrons move.

Answer:

D

Explanation:

D

Muslims and Persians stressed perfect __________ in their architectural designs so that each side of a building would look exactly the same as the others.
A.
angles
B.
slopes
C.
texture
D.
symmetry

Please select the best answer from the choices provided
A
B
C
D

Answers

Answer:

b

Explanation:

from the big bang that occurred 13.7 billion years ago came​

Answers

Answer:

huh

?

I'm confused on the question

Answer:

Our universe was born about 13.7 billion years ago in a massive expansion that blew space up like a gigantic balloon. That, in a nutshell, is the Big Bang theory, which virtually all cosmologists and theoretical physicists endorse. The evidence supporting the idea is extensive and convincing

Explanation:


Glycemia refers to the amount of glucose in a person's blood. What does it mean that the patient was
hyperglycemic? Why did this affect the doctor's decision to give the patient a normal IV?

Answers

Explanation:

A person that is Hyperglycemia has a high blood pressure causing problems, iv help maintain people blood sugar if u use a normal iv it might cause a high blood pressure can cause blood clot to form in your arteries leading to the brain blocking blood flow causing a stroke. I hope this helps

Location of Station Time Between Arrival of P and S Waves Approximate Distance from Epicenter Length of Radius of Circle (in cm) 1 Buenos Aires 1 min. 50 sec 1,600 km Lima 3 min, 45 sec 2,400 km Brasilia 4 min, 5 sec 2,880 km​

Answers

Answer:

1600km * 2 / 1000 = 3.2cm

2400km* 2/ 1000 = 4.8cm

2880km * 2/ 1000 =5.76cm

Explanation:

Diffusion in membrane cell

Answers

Diffusion is one form of passive transport that doesn't require the expenditure of cellular energy. A molecule can diffuse passively through the cell membrane if it's lipid-soluble, uncharged, and very small, or if a carrier molecule can assist it. ... The assisted process is known as facilitated diffusion.

Got this off google but still hope it helps :)

Answer:

when small molecules pass through the lipid bilayer of a cell membrane simple passive diffusion occurs

Explanation:

Diffusion is one form of passive transport that doesn't require the expenditure of cellular energy. A molecule can diffuse passively through the cell membrane if it's lipid-soluble, uncharged, and very small, or if a carrier molecule can assist it. ... The assisted process is known as facilitated diffusion.

what makes a compound different than a mixture

Answers

Compound are substances which can be formed by chemically combining two or more elements. Mixtures are substances that are formed by physically mixing two or more substances.

How are the graphs of a body chemical controlled by negative feedback and a chemical controlled by positive feedback similar and how are they different

Answers

Answer:

two examples of positive feedback loops that are normal but are activated only when needed. Childbirth at full term is an example of a situation in which the maintenance of the existing body state is not desired.

Explanation:

18
What part of the water cycle is represented by arrow Y?
w
(z
A evaporation
B precipitation
condensation
D runoff

Answers

B. precipitation

Rain,snow, sleet or hail are all a form of precipitation. And looking at that picture Y would be rain :)

Answer:b

Explanation:

What is a stimulus?
there are no options actually so plz help thank you

Answers

Answer:

In general, a stimulus is something that provokes or causes an action or response, as in Failing that test was the stimulus I needed to start studying harder. The plural of stimulus is stimuli. Its verb form is stimulate, which typically means to spur into action or to invigorate.

Explanation:

Answer:

In physiology, a stimulus is a detectable change in the physical or chemical structure of an organism's internal or external environment. The ability of an organism or organ to detect external stimuli, so that an appropriate reaction can be made, is called sensitivity

Explanation:

it just is

Can u help me please the graph is on the other question that I had just recently asked please and thanks.

Answers

Answer:

16. They would compare it the other strand of DNA from other organisms and try to see which one is most similar to organism x

for 17 and 18 could u post the graphs

Help me with 2 please if you know it !!!!!!

Answers

The answer to the question is “A”

Write main four differences between chemical fertilizers and organic fertilizers

Answers

Answer:

The four difference between chemical fertilizers and organic fertilizers are following :•

chemical fertilizers prepared in industries whereas organic fertilizers prepared in fieldchemical fertilizer does not provide humus to the soil whereas organic fertilizers provide humus to the soilin chemical fertilizer , these are chemical that are added to the soil to increase its fertility and productivity. whereas in organic fertilizers, These are obtained from dead and decaying plants and animals.Rich in plant nutrients whereas Less rich in plant nutrients

Other Questions
Help please. Thank you. solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons. one of u guys helped me but they keep returning it saying show your work>:( how do you find the area of a triagnle and a rhombus in gerneral Present at least one paragraph describing your experience will the illusions lab. What are your thoughts about the experience? Which illusion was your favorite? Lisa is in the eighth grade. Normally she is active in clubs, plays sports, and gets good grades, but lately she hasn't been feeling well. Her throat issore and her lymph nodes feel swollen. She is running a fever and feels exhausted all of the time.Lisa's doctor diagnoses her withand tells her that although she can treat the fever, she cannot prescribe antibioticsbecause Lisa's disease is viral. She recommends that Lisa forego sports and cut way back on her activities. She may not be able to go to schoolfor several weeks.What did the doctor diagnose her with??? Hamburger buns come in packages of 12. Hamburger patties come in packages of 8. Bob would like to buy the smallest number of hamburger buns and hamburger patties so that he will exactly one hamburger patty per bun. How many packages of hamburger buns and hamburger patties must he buy?PLEASE ANSWER QUICK I WILL GIVE LOTS OF POINTS