Which statement explains the primary cause of the Cold War between the United States and the Soviet Union?

A. The two nations were enemies during both world wars, and the rivalry carried over into peace time.

B. The two nations specialized in similar products and were competitions in the international trade market.

C. The two nations had opposing political, economic, and social ideologies.

D. The two nations disagreed on the establishment of the United Nations.

Answers

Answer 1

Answer:

the Marshall plan

Explanation:

the Eve of German surrender the soviet union occupied much of the west. neither the west nor east could decide how Europe should de split up. the soviet union wanted more control and the western allies also wanted more control.

Answer 2

The two nations were enemies during both world wars, and the rivalry carried over into peacetime which explains the primary cause of the Cold War between the United States and the Soviet Union. The correct option is A.

Who primarily caused the Cold War?

Both the United States and the Soviet Union contributed to the Cold War's growth. They were ideological nation-states with philosophies that were irreconcilable and mutually exclusive. The Soviet Union's founding goal was worldwide dominance, and it actively pursued the destruction of the US and its allies.

Historians have identified various explanations for the commencement of the Cold War, including tensions between the two countries at the close of World War II, an ideological dispute between the US and the Soviet Union, the introduction of nuclear weapons, and the American dread of communism.

Thus, the ideal selection is option A.

Learn more about the Cold War here:

https://brainly.com/question/12698715

#SPJ2


Related Questions

pls help i’ll give brainlist… i think i can

Answers

Answer:

The Mexican War of Independence (Spanish: Guerra de Independencia de México, 16 September 1810 – 27 September 1821) was an armed conflict and political process resulting in Mexico's independence from Spain.

why will a cold glass of soda remain carbonated longer than a warm glass of soda

Answers

Ice or coldness in the glass creates more surface area for the attachment of the carbonated gas. Condensation against the cold glass surface reduces the dissolving rate of the gas.

Europe is known for its extensive railroad system and even has a tunnel that
stretches under the English Channel to connect the United Kingdom to the rest of
Europe.

A: True
B: False

Answers

B the US has an extremely extensive railroad system not Europe

What was the Eisenhower doctrine?

Answers

Answer:

The Eisenhower Doctrine was a policy enunciated by Dwight D. Eisenhower on January 5, 1957, within a "Special Message to the Congress on the Situation in the Middle East"

Explanation:

Read the passage from The Pillow Book. "Women who have served in the Palace, but who later get married and live at home, are called Madam and receive the most respectful treatment. To be sure, people often consider that these women, who have displayed their faces to all and sundry during their years at Court, are lacking in feminine grace. How proud they must be, nevertheless, when they are styled Assistant Attendants, or summoned to the Palace for occasional duty, or ordered to serve as Imperial envoys during the Kamo Festival! Even those who stay at home lose nothing by having served at Court. In fact they make very good wives. For example, if they are married to a provincial governor and their daughter is chosen to take part in the Gosechi dances, they do not have to disgrace themselves by acting like provincials and asking other people about procedure. They themselves are well versed in the formalities, which is just as it should be.” What conclusion can be drawn about the author’s point of view in this passage? Women who serve in the court are not graceful. Serving in the palace benefits women later in life. Serving in the palace should be the goal for all women. Women who get married later in life receive the most respect.

Answers

Answer:

The answer is the second option

Explanation:

Need help or ima failll

Answers

Answer:

c

Explanation:

If you want to pass you'll put c.

If the President and Congress disagree over a tax bill, the President can veto the bill. Which of principle of democracy applies to a presidential veto?

Answers

Answer:

Checks and Balances

Explanation:

What did the Fourth Amendment do?

A: allowed freedom of speech

B: bans the government from unreasonable searches and seizure of an individual or their property

C: prevented the quartering of soldiers

D: allowed for trial by jury


please help its due today, thank you to whoever helps.​

Answers

Explanation:

B: bans the government from unreasonable searches and seizure of an individual or their property

when the british declared martial law in massachusettes

Answers

Answer:

1774

Explanation:

Answer to the question is 1774

Question 1 of 5
The Scramble for Africa was the beginning of...

A the slave trade in Africa,

B Portuguese trade posts in Africa,

C European seizing settlements in Africa,

D Europeans making a serious effort to seize African lands.

Answers

Answer:

The Scramble for Africa, also called the Partition of Africa, or the Conquest of Africa, was the invasion, occupation, division, and colonization of most of Africa by seven Western European powers during a short period known to historians as the New Imperialism (between 1881 and 1914). The 10 percent of Africa that was under formal European control in 1870 increased to almost 90 percent by 1914, with only Ethiopia (Abyssinia) and Liberia remaining independent, though Ethiopia would later be invaded and occupied by Italy in 1936.

Explanation: hope this helps (:

why did theodore roosevelt choose to leave the republican party and run as an independent? how would the formationd of the progressive "Bull Moose" party help democratic candite
plz help ​

Answers

Answer:

The Progressive Party was popularly nicknamed the "Bull Moose Party" when Roosevelt boasted that he felt "strong as a bull moose" after losing the Republican nomination in June 1912 at the Chicago convention. ... In the 1908 presidential election, Roosevelt helped ensure that he would be succeeded by Secretary of War Taft.

why did buddhism appeal to many people in various parts of asia?

Answers

Answer:

It appealed to many parts of Asia, because everyone wanted to reach a state of Nirvana (inner-peace)

Explanation:

! 20 points !

Describe two problems the American Government had with the Mormons.

Answers

The government was persecuting them and Governor Bogg was issuing an exterminating order against them. The state of Illinois also asked them to leave. They also wanted to escape the non Mormons who were called Gentiles

which holiday treat was a vehicle for alcohol during prohibition?

Answers

Based on historical context, the holiday treat that was a vehicle for alcohol during prohibition is "Eggnog."

History of Eggnog

Originally, Eggnog is a form drink that contains eggs, milk, and sugar, majorly as an ingredient. The history of Eggnog can be traced to England.

However, during the prohibition era, which lasted between 1920 to 1933, the Eggnog producers or makers tended to add rum or alcohol to the mix, which gave people a chance to take alcoholic drinks. It is served chiefly during Christmas.

Hence, in this case, it is concluded that the correct answer is "Eggnog."

Learn more about Prohibition Era here: https://brainly.com/question/8861080

help me with this please​

Answers

Answer:

Explanation:

BTW i have a confession so please answer if u wanna hear it...

* Why would the phrase "Remember
the Maine" lead to more people favoring
war with Spain

Answers

Answer:

* Why would the phrase "Remember the Maine" lead to more people favoring war with Spain

Explanation:

* Why would the phrase "Remember the Maine" lead to more people favoring war with Spain

where to find finneon in pokemon brilliant diamond

Answers

Answer:

what is this?

Explanation:

Answer:

Finneon, the first form of Lumineon, can be found and caught with the Good Rod in Brilliant Diamond and Shining Pearl. Finneon spawns in the water near Routes 205, 218, 219, 220, and 221, as well as Canalave City, Iron Island, Fuego Ironworks, and Valley Windworks.

Explanation:

Im a pokemon otaku, and I know my stuff

enslaved Africans resist slavery in english colonies slavery by

Answers

Answer:

Feigning illness, working slowly, producing shoddy work, and misplacing or damaging tools and equipment.

Explanation:

Although these examples are less obvious ones and probably don't have anything to do with the article you may be reading I hope these help

They would work slowly and break the tools they needed to crop the crops. hope this helps :) please give brainly

Virginia has 11 people in the house and 2 in the senate how many electrons votes does it have

Answers

Answer: Total electrical votes/ 538

Explanation: Give me the brainiest

Drag and drop in order the sequence of events, from first to las

Answers

The Spanish conquest, Jamestown, Yorktown, and then the constitutional convention

Which of these were important national issues in the 1840s and 1850s? A. Financial crisis and the environment B. Fear of invasion from Mexico and the territories C. Highways and education D. Immigration and slavery

Answers

Statement that serve as  important national issues in the 1840s and 1850s is D. Immigration and slavery.

Around 1850s, the conflict as regards slavery can be regarded as a national issue which almost made United States to experience destruction.

And this always brings about unsettlement in the nation's political institutions as well as its public places.

Therefore, Immigration and slavery can be regarded as national issues around 1840s and 1850s.

Learn more about national issues in the 1840s and 1850s at:

https://brainly.com/question/18259799

Answer 1-5 Please and Thankyou.​

Answers

Answer:

please I can only answer 1 question what question I can answer please tell me

Explanation:

#1

The strategy of "containment" is best known as a Cold War foreign policy of the United States and its allies to prevent the spread of communism after the end of World War II.

The definition of cold war is hostility between areas, states or nations without physical fighting. An example of a cold war was the relationship between the USA and the USSR after World War II.

#2

The main reason the United States got involved in Korea was the purpose of doing everything possible to keep communism from spreading around world. Truman argued that the United States should actively support the containment of Soviet Communism in the years immediately after World War II.

#3

The United States government was initially hostile to the Soviet leaders for taking Russia out of World War I and was opposed to a state ideologically based on communism. .However, the Soviet stance on human rights and its invasion of Afghanistan in 1979 created new tensions between the two countries

#4

The actions by governments of communist states have been subject to criticism across the political spectrum. According to the critics, the rule by communist parties leads to totalitarianism, political repression, restrictions of human rights, poor economic performance and cultural and artistic censorship.

#5

Beginning in the early 1970s, the Soviet regime proclaimed a policy of détente and sought increased economic cooperation and disarmament negotiations with the West. However, the Soviet stance on human rights and its invasion of Afghanistan in 1979 created new tensions between the two countries

what date was the monarchy overthrown in the french revolution

Answers

Answer:

During the French Revolution, the proclamation of the abolition of the monarchy (French: Proclamation de l'abolition de la royauté) was a proclamation by the National Convention of France announcing that it had abolished the French monarchy on 21 September 1792.

Explanation: Hope that this helped!

Which detail is most important to include in this essay?

In feudal Japan, many people worked as farmers and had little money.
Japanese warriors spent a lot of time waiting to be called on by their lord.
In feudal Japan, wealthy people hired warriors for protection against enemies.
Today’s Japanese warriors have an ancient link to samurai women of the past.

Answers

Based on the information given in the essay, the most important detail to include is B. Japanese warriors spent a lot of time waiting to be called on by their lord.

It should be noted that the Samurai were members of a powerful military caste that was in feudal Japan.

The Samurai began as provincial warriors before they rose to power in the 12th century when the first military dictatorship that was referred to as the shogunate emerged. During this period, Japanese warriors spent a lot of time waiting to be called on by their lord.

Learn more about warriors on:

https://brainly.com/question/10941959

Can someone plz help me? :(

Answers

Answer:

I think it's A

Explanation:

Hope this helps

1.1.2.3.4.5.6.
7.8.9
IMAGE #1
1. What do you see in this image? Based on what we have learned, what do you think this represents?
Answer here:

Answers

Answer:

I dont see an image

Explanation:

In chapters (Matthew) 5-7, there is a grouping of the [blank] of Jesus.​

Answers

Answer:

Satire?

Explanation:

where was the first retail christmas tree lot in america

Answers

new york................................:)

how did river valley civilizations influence classical civilizations

Answers

Answer:

River valleys (Summer of Mesopotamia, Egypt, Indus, and Huang He (Yellow River) China helped to shape the later classical civilizations (meaning Greece, Rome, Persia, etc.). Social stratification (hierarchies) are all examples of how river valley civilizations influenced the classical civilizations.

Explanation:

Which theory states that laws should be ignored and governments should be
eliminated?

A.anarchism

B.capitalism

C.communism

D.socialism

Answer:

Answers

The correct answer is A. Anarchism
Other Questions
What happened In world war SOLVE HYPOTENUSE LEG-HL-GEOMETRY What is the main idea of Hayess statement?A. He will let the South govern as it wishes.B. He will only look out for Northern interests.C. He will work to unite the interests of North and South.D. He thinks that the division between North and South is important.I think the Answer is "C". 1 2 3 4 5 6 7 8 9 10TIME REMAINING55:47A bill can be either __________, meaning that its contents and the discussion surrounding it are open to anyone, or __________, meaning that most discussions about the bill take place behind closed doors and are not widely known.A.censored . . . openB.hidden . . . privateC.public . . . privateD.public . . . exposedPlease select the best answer from the choices providedABCDMark this and return (If you don't know, don't answer)How can I solve them?1. 44=t722. 18+z=403.18(f)=914. 57=y25. 14=d+(10) In the convention of 1818 what did the U.S obtain from this treaty ?? AC current is produced by which of the following things? A. Remotes B. Generators C. Lights D. Lasers What is the area of a room that is 3 3/4 yards long by 3 1/3 yards wide? In which situation would a photographer most likely use butterfly, or paramount, lighting?landscape photographywildlife photographyaction photographyfashion photography 1 less then the quotent of a number n and 6 Draw the Lewis structures forCalcium bromide, CaBr2 What did farmers want the government to regulate in the late 1800's?1. Steel mills2. Unions3. Railroads4. Banks AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA Order the angles in the triangle above from largest to smallest.Largest1.B2.D3.Smallest Does technology always follow the science,yes or no explain why to choice A body of laws and rules defining the relationship between the government and the people is called:the pacta constitutiona judiciarya treaty Source 1 Pitts' Flash Mob Robberies articleTopic sentence 1 What does this article show about mob mentality? how to factorize 5x^2-20y^2 Sam runs 6 miles in 55 minutes. At the same rate, how many miles would he run in 44 minutes? Which graph represents a function?