Which states that the force of gravity acts between all objects in the universe. The scientists that discovered this was

Answers

Answer 1

Answer:

Gravity is a force of attraction that exists between any two masses, any two bodies, any two particles. ... It is an attraction that exists between all objects, everywhere in the universe. Sir Isaac Newton (1642 -- 1727) discovered that a force is required to change the speed or direction of movement of an object.

Explanation:

please give me brainlist and follow


Related Questions

After the Civil War, the plantation slavery system was replaced by sharecropping. There were both benefits and
drawbacks of this new system. Choose ALL true statements about the impacts of sharecropping.
A)
It made most freed people wealthy as their farms grew.
B)
It tended to keep African Americans in long-term debt.
c)
It gave freedoble the ability to farm for themselves.
Eliminate
D)
It created a booming economy in the South during Reconstruction.
E)
It benefited landowners, as they would receive part of the crops.

Answers

The %100 right Answer is:

The letter (B), (C), and (E) on Edge in 2022.

Explanation:

The wrong options are letter (A), and (D) only.

B.T.W

I Hope This Helped you guys.

It tended to keep African Americans in long-term debt, free double the ability to farm for themselves, and benefited landowners, as they would receive part of the crops. Thus, options B, C, and E are correct.

What is slavery?

When a person is owned by another person, slavery is said to have occurred. In this case, the person in question is not receiving any compensation for the work or services he performed for the other person, and he is also not receiving humane treatment is slavery

It gave African Americans the opportunity to cultivate for themselves, offloaded two people from long-term debt, and helped landowners because they'd earn a portion of the harvests. Sharecropping took the role of the plantation system of enslavement after the Civil War. This proposed program had both advantages and disadvantages.

Therefore, option  B, C, and E is the correct option.

Learn more about slavery, here:

https://brainly.com/question/9331183

#SPJ6

Which of the following is NOT considered one of the five themes of geography?
A)source
B)region
C)place
D)location

Answers

the answer is D)source

What branch of the US government officially "declares war"?

Answers

Congress

Explanation:

The Constitution grants Congress the sole power to declare war.

In the United States, Congress, which makes the rules for the military, has the power under the constitution to "declare war".

what problem still exist in enforcing title ix

Answers

Answer:

Title IX of the Education Amendments of 1972 protects people from office for Civil Rights (OCR) enforces, among other statutes. Some key issue areas in which recipients have Title IX obligations

Explanation:

Are we born good or bad?

Answers

Answer:

Good,

Explanation:We are born good because are actions reflect on what are future will become!

Answer:

We are born good

Explanation:

All of the following were established as law by the Wagner Act of 1935 EXCEPT:
A.
the right to join a union
B.
the right to participate in collective bargaining
C.
the right to go on strike
D.
the right of employers to fire employees for union membership

Answers

Explanation:

A. Bargain with a duly elected representative of the employees. ... Refrain from coercing employees to vote "no" in a union election.

All of the following were established as law by the Wagner Act of 1935 EXCEPT: the right to join a union. Thus the correct answer is A.

What is a law?

A collection of rules and regulations obliged an individual, as well as an organization to maintain peace and harmony along with a code of conduct enforceable by the constitution which is considered as law.

It examined the relationships between employers and labor unions in the private sector and formed the National Labor Relations Board. Collective bargaining is open to employees. This indicated that employees had the right to negotiate with their employer about their benefits and wages.

It allows workers to go on strike to force employers to fulfill their demands and provides rights to employers to remove employees who have participated in union membership.

Therefore, option A the right to join a union is appropriate.

Learn more about the Wagner Act of 1935, here:

brainly.com/question/10137348

#SPJ2

Identify and explain two possible barriers to communication within the bank​

Answers

Answer:

Lack of attention, interest, distractions, or irrelevance to the receiver.

Explanation: Differences in perception and viewpoint. Physical disabilities such as hearing problems or speech difficulties.


2. What were Greek schools called? What subjects did Greek boys study? How
did they do their lessons? What did Greek girls study?

Answers

Answer:

1.

2. Children were trained in music, art, literature, science, math, and politics. In Athens, for example, boys were taught at home until they were about six years old. Then boys went to school, where they learned to read and write. They learned to play a musical instrument, usually the flute or the lyre.

3. Boys started school at the age of seven. They were taught how to read, write and learned a lot of poetry by heart. In places such as Athens laws were carved into stone , so citizens had to be able to read to make sure they didn't break the law. (The second photograph here shows a Greek inscription in stone.)

4. Greek females didn't go to school

Explanation:

Read the following prompt and type your response in the space provided.
The biography "'Equal Justice Under Law": Thurgood Marshall" and "On the Front Lines With Marshall: An Interview With Jack Greenberg" portray events in Thurgood Marshall's life.

Compare and contrast the events described in the two texts. Make sure to use evidence to support your answer. You may refer to the texts.

Answers

Answer:

sad

Explanation:

what's the answer a b c or d​

Answers

Answer:

b. it confuses correlation with causation

Which quality should you look for in a person of influence who will be the topic of an essay?
O The person should create controversy.
O The person should be on the news frequently.
O The person should play an important role in history.
O The person should not be well known.
Social studies

Answers

Answer:

The person should play an important role in history.

Answer:

The person should create controversy

Because resources are limited and demands are unlimited, societies and individuals must make choices about what to produce and what to consume. This economic concept is..

Answers

Answer:

Scarcity

Explanation:

Scarcity as it is widely known connote an event or situation in which unlimited wants is more than the the limited resources available to meet the demands or fulfill those wants. It is also known to be the common economic problem of having unlimited wants, but limited resources to meet those wants.

Resources needed by man most importantly are little or limited in their supply. Human wants are those things that humans needs and they are unlimited in nature. Due to the scarcity of Resources are scarce, humans have tomake choices and drop out some of their wants to be able to fulfill the much needed one.

Help quick please! ill mark brainliest if correct just please

Answers

Answer:

ok

Explanation:

freed african american slaves from in both union and confedirancy

Do we need political parties in the United States (claim, evidence, and reasoning needed) PLEASEEE HELP!!!

Answers

Claim: The United States of America needs political parties in the country to maintain a sense of division among its citizens.

Evidence:
-not everyone has the same opinions, this division will always exist, this way it is more orderly
- having political parties is a good way to separate our candidates for elections
- political parties establish a sense of common ground within citizens who share the same beliefs/morals/etc

hope this helped; mark Brainly please

ECONOMICS
Examine the supply and demand schedules for headphones. How much would a seller charge if he or she wanted to sell headphones for their equilibrium price? A. $100 B. $50 C. $125 D. $25

Answers

Answer:

100

Explanation:

A P E X

Answer:

B. $50 is your answer

Explanation:

just took the quiz

true or false ? More revolutions took place in Europe in 1848 than any other year from 1815 to 1859

Answers

Answer:

true

Explanation:

Revolutions of 1848, series of republican revolts against European monarchies, beginning in Sicily and spreading to France, Germany, Italy, and the Austrian Empire. They all ended in failure and repression and were followed by widespread disillusionment among liberals.

Answer:

True

Explanation:

please mark the brainliest dear...

recommend THREE ways the national government could help fight gender-based violence? ​

Answers

Answer:

make sure people get treated the same , and get called by there pronus also to be freee

Explanation:

Why is resource immobility a problem in a market

Answers

Answer:

Factor immobility is a cause of market failure.

Explanation:

The free market fails to provide an efficient allocation of resources because of the geographical and occupational immobilities. Inequality. Factor immobility can lead to increased inequality.

the person that answers was correct

Define currency and write down the specialities of currency​

Answers

Answer:

The fact or quality of being general accepted or in use in a particular country is called currency.

The  specialities of a currency are

1.Nation cannot print notes\money as their wish or want.

2.The country needs to keep its valuable things like gold as a security against the value of currency.

3.The currency of a country also reflects the capability of its citizens.

4.Currency is used to import and export necessary goods.

Explanation:

The transaction of goods and services typically takes place using money/ Currency. In a nutshell, it's currency, usually, in the form of coins and paper, that is issued by governments and widely recognized for use as payment at face value.

Why is it called currency?

The Latin term "currere," which means "to run" or "to flow," must be used to create a currency. Contrarily, the term "money" is derived from the Latin verb "monere," which means "to warn."

Anything that is commonly acknowledged to be valuable and may be used as a means of exchange to exchange for goods and services is referred to be currency. An economy's trade system is built on its currency, which is typically unique to a particular nation and issued by that nation's government.

Thus, Durability, mobility, divisional ease, consistency, scarcity, and acceptability are the qualities of money.

Learn more about Currency here:

https://brainly.com/question/14372075

#SPJ5

How many ways can Rudy choose 5 pizza toppings from a menu of 7 toppings if each topping can only be chosen once?

Answers

Answer:

. Therefore there are four(4) ways in which rudi can choose pizza toppings.28 Jun 2018

Answer: choos 5 toppings

Explanation:you have 5 choices out of 7

Which part of the brain acknowledges events and adds feeling-memory to the emotional process ?

Answers

Answer:

Amygdala

Explanation:

The government of ________________ is a dictatorship where the citizens have limited freedoms, while the government of __________ is democratic where the citizens experience personal freedoms. A. Cuba, Latin America B. Mexico, Cuba C. Brazil, Cuba D. Cuba, Mexico i need help asap! thanks!

Answers

Answer:

ay good luck :3

Explanation:

:3

Which of the following is NOT a type of pet that the Egyptians kept? Baboons ,Dog, Lion , Monkeys​

Answers

Answer:

None of the above

Explanation:

All stated are animals the Egyptians kept

Answer:

lion

Explanation:

got it right on the quiz :)

In which country would the citizens most likely have a very limited or no right at all to free speech? *

A.Mexico
B.Brazil
C.Cuba
D.The United States of America

Answers

Answer:

C: Cuba

Explanation:

Cuba is suppressed by military control against freedom of speech. One could argue that Mexico is worse, but it did give it's citizens the right to freedom of speech...supposedly.

I believe the answer is C. Cuba

What did Stephen Douglas claim Lincoln wanted for African Americans?

Answers

Answer: In 1854, amid sectional tension over the future of slavery in the Western territories, Senator Stephen A. Douglas proposed the Kansas-Nebraska Act, which he believed would serve as a final compromise measure.In the long term, the Lincoln-Douglas debates propelled Lincoln's political career into the national spotlight, while simultaneously stifling Douglas' career, and foreshadowing the 1860 Election. ... Lincoln was also a member of a relatively new anti-slavery party—the Republican party.

Hope this helps have a awesome day/night❤️✨

Explanation:

Trees are a natural resource in Arkansas. They are often harvested for lumber. How does Arkansas keep this natural resource from being depleted?

(1.7 Arkansas Geography Test Study Guide SS 7B)
also connexus (school) iykyk

Answers

Answer:

Arkansas used in Arkansas Wildlife Action Plan, forests ensure that all natural resources are sustained in a manner to provide, maintain and enhance the economic benefits and values of trees and forests, Arkansas is an important wood producer, contributing 3.5 percent of the total

Explanation:

Create your own disc jockey rhyme create a rhyme at least ten lines long HELP I’ll CASH APP AND MARK BRAIN LIST

Answers

Answer:

d

Explanation:

According to O*NET, a career as a barber requires the following skills: active listening, speaking, monitoring, social perceptiveness, and service orientation. Based on skills, which of the following students is most likely to succeed as a barber?

(A) Chris, who has an interest in hairstyles.

(B )Anna, who runs the register at her mother’s salon

(C )Brad, an extrovert who is the life of any party

(D) Sophie, who started a student support hot line for students in crisis

Answers

Answer:

(D) Sophie, who started a student support hot line for students in crisis

Explanation:

Although each of these students has interests, qualities, or knowledge that could be useful, Sophie’s social awareness and service orientation are skills that would help her succeed as a barber.

Based on the required skills, the student who is most likely to succeed as a barber is Chris, who has an interest in hairstyles. The correct option is A.

What are skills?

Skills are specific abilities or competencies that individuals acquire through training, education, or experience and that enable them to perform particular tasks or activities effectively.

They can be cognitive, such as problem-solving and critical thinking, or physical, such as manual dexterity and coordination. Other skills include social or interpersonal skills, such as communication and teamwork, and personal skills such as self-management and resilience.

Based on the required skills, Chris, who has an interest in hairstyles is the student who is most likely to succeed as a barber. Thus, the ideal selection is option A.

Learn more about skills here:

https://brainly.com/question/1414531

#SPJ2

Elabora un listado de los aportes científicos y culturales que dejó el renacimiento para la humanidad

Answers

La respuesta correcta para esta pregunta abierta es la siguiente.

Los aportes científicos y culturales que dejó el renacimiento para la humanidad fueron los siguientes.

Una de las principales aportaciones de la época del Renacimiento fue la Imprenta, desarrollada por Gutenberg a mediados del siglo XIV, tomando conceptos de la antigua China.

La Famosa teoría Heliocéntrica desarrollada por el famoso astrónomo Nicolás Copérnico, también es una de las grandes invenciones científicas del Renacimiento.

Oto gran astrónomo, Galileo, fue quien desarrolló con mayor precisión lo que conocemos como telescopio para observar las estrellas y otros planetas.

Aunque la brújula fue inventada por los Chinos, en la Europa Renacentista se perfeccionó su uso en las exploraciones a través dela navegación.

Canada has provinces and three territories.

Answers

Yes canada has ten provinces and three territories

Alberta, British, Columbia, Manitoba, New Brunswick, Newfoundland

and Labrador, Northwest Territories, Nova Scotia, Nunavut, Ontario, Prince Edward

Island, Quebec.

Other Questions
un debate sobre temas controversiales como lalegalizacin de las drogas, la homosexualidad, la eutanasia y lamigracin. Toma en cuenta estructura. 7. Find the inverse of f(x) = -2x + 10. Please show work. Which is NOT a type of crowd?ConventionalO FormativeO CasualO Expressive A slide at a children's park is 74 inches tall in the horizontal distance The slide covers is 70 inches what is the angle measures created by the slide and the ground a cyclist covers a distance of 15km in 2hours calculate his speed Who suspects Macbeth of foul play? 6.The bolded words are " I long to hear you", and " I long to hear you".Read the following passage from Shenandoah. Which sound device is expressed by the bolded words?Shenandoah, I long to hear you,Away, you rolling river,Oh, Shenandoah, I long to hear you,Away, I'm bound away,'Cross the wide Missouri.A. refrainB. repetitionC. alliterationD. rhyme Civil rights in the United States are meant to make sure that: A. all races are treated equally. B. states can segregate services. C. the courts don't have too much power. D. schools get enough money to operate.I will give brainliest. Question 1 ( point) A 64g sample of Germanium-66 is left undisturbed for 12.5 hours. At the end of that period, only 2.0g remain. How many half-lives transpired during this time period? half-lives Answer = Blank 1: The sum of a number and six times its reciprocal is 10. Find the number If this work is a throne for the greatest rapper, who should occupy it? Make a case. What is the meaning of the term metabolism? The term "para" in Paralympics means? Use the points in each diagram to name the figure shown what is - 5 = -2 what is the questionwhat is the question Solve for x. Enter the solutions from least to greatest. (5x+4)(x3)=0lesser x= greater x= what's the fourth proportional of 0.2, 0.5, 6 transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- What is the best name for polynomial with 3 terms that has a degree PLEASE HELP ITS DONE IN 16 HOURSSS!!!question: A substance with 12 negatively charged atoms combined with a substance that has 10 positively charge atoms. What is the total charge of the substance when the atoms are combined?answer options: +22-22+2-2