Why is it that dominant diseases are not as common as recessive ones?

Answers

Answer 1

Answer:

Mainly because if a disorder is dominant, then it will be manifested by all who have the gene. If the disorder is severe, then it will reduce the chances of the individual surviving to grow up and reproduce (unless the disorder only manifests symptoms in later life). If they do reproduce, then 50% of their offspring will inherit the gene, and be at a similar disadvantage in reproduction. Thus, there is likely to be selection against the gene. By contrast, a recessive disorder is only manifested if both parents pass on the abnormal gene, and an individual with one gene for the disorder is usually at no disadvantage. Thus, there is much less selection against abnormal recessive disorders.


Related Questions


True and False:
1. (______) Fungi and bacteria are both prokaryote organisms

2. (______) Some Fungi reproduce both sexually and asexually.

3. (______) Saccharomyces cerevisiae reproduce sexually by budding.

4. (______) Lactophenol cotton blue is mostly used for staining the dark mold

5. (______) Yeast is regarded as multicellular fungi and molds are unicellular fungi.

Answers

Answer:

1. Falso

2. Falso

3. Verdadero

4. Falso

5. verdadero

Explanation:

1. Las células de los animales, las plantas y los hongos son eucariotas

2. Los hongos se reproducen sobre todo por medio de esporas

3. cerevisiae se reproduce tanto asexual y sexualmente levaduras se reproducen asexualmente mediante un proceso conocido como gemación.

4. La tinción de Azul de lactofenol se emplea para observar hongos.

5. Los hongos pueden ser unicelulares o pluricelulares. Las levaduras son hongos unicelulares

similarities between the computer and the human body.

Answers

Answer:

Both of them have memory, both of them use electrical signals, both of them can retrieve and transmit data, both of them have partitions and both of them connect data in order to reach to conclusions which are logical and working

Explanation:

Many livestock are being grazed on public lands because the fees to graze on public lands are cheaper than the fees for private lands. If we aren't careful, what can this cause? A. owners moving their livestock TO private lands B. increased fees for private lands C. overgrazing on public lands D. overgrazing on private lands​

Answers

Answer:

I would say that this would cause "overgrazing on public lands."

Explanation:

When people see that the fees are cheaper, they would send their livestock there. It might be alot of livestock though

Do you think people should be able to patent DNA? Should people have the right to trademark their own DNA? Explain why or why not.

Answers

Yes because dna is a food made from the pressed curds of milk.
"grated cheese"





2.
INFORMAL
the quality of being too obviously sentimental.
"the conversations tend too far toward cheese"
Feedback
Translations and more definitions a food made from the pressed curds of milk.
"grated cheese"





2.
INFORMAL
the quality of being too obviously sentimental.
"the conversations tend too far toward cheese"
Feedback
Translations and more definitions

The question 38 I can’t understand the question clearly

Answers

Answer:

The words are too blur for me darling

Explanation:

Maybe next time^^

P I E C K

___________

HELP QUICKLY Why are the deepest high tides so deep and the shallowest low tides so shallow? Hint: how are the Earth, Sun, and Moon aligned?

Answers

There are different kinds of tides. This change occur because  when the gravitational pull of the sun works along with the gravitational pull of the moon on Earth, it leads to the oceans bulging out.

This result above makes the high tides as been little higher and low tides been little lower than normal.

Spring tides are known to be the deepest as oceans levels are highest in this kind of tide. The neap tides are known to be the shallowest.

This often occurs when the moon, earth, and sun are said to be at a right-angled plane.  Therefore, the gravitation pull of the moon and sun on the oceans do counteract each other making its net effect is smaller.  

Learn more about Tide from

https://brainly.com/question/1133278

I want a sister I can’t live like this with my parents

Answers

[tex] \large \sf{ah ! \: now \: what \: you \: will \: do?} \\ \large \sf{what \: did \: you \: decide?}[/tex]

PLS HELP WHAT SHOULD I WIRTE?)
Write your own acrostic poem using the word "THANKFUL". You can use words or phrases for each line. Make sure to write about what you are thankful for.

Answers

Opening my eyes
And observing the skies
Feeling my mom's touch
And kissing her a bunch
As i watch her smile
Showing her mesmerizing teeth
Going out on saturdays
And watching friends on sundays
Is what i am thankful for everyday

Which of the following is NOT an example of a phenotype?
a. Wheat resistance to fungal infection
b. DNA sequence of the alcohol dehydrogenase gene
C. Color of a feather
d. Height of a giraffe

Answers

The answering would be A.

complete the crossword puzzle below.

down
1. a fat molecule is composed of _____ And 3 fatty acids.
2. means that hydrogen has been added to unsaturated fats
4 a large molecule whose main function is energy storage
6. unsaturated fats have move _____ bonds than saturated

UP
3. lipids are water-avoiding or _____
5. female and male hormones are example of ____
7. animal fats are said to be ____
pa help Po plss​

Answers

Answer:

1 down  hydroxyl

2 down Hydrogenation

4 down lipids

6 down

3 up

5 across androgen

7 up

Explanation:

that is all ik

Explain how cells theory development

Answers

Answer:

The invention of the microscope led to the discovery of the cell by Hooke. While looking at cork, Hooke observed box-shaped structures, which he called “cells” as they reminded him of the cells, or rooms, in monasteries. This discovery led to the development of the classical cell theory.20-Aug-2020

Explanation:

hope this. helpes

Please mark Brainliast

Which phrase best describes what a soil horizon is?
A the bottom layer of a soil profile
B each layer of a soil profile
C the place where two soil profiles meet
D the place where a soil profile meets bedrock​

Answers

Answer:

I suppose the answer is C

Each layer of a soil profile best describes a soil horizon.

What is a soil horizon?

A soil horizon is a layer of soil within a soil profile. A soil profile is a vertical section through the soil, showing the different layers, or horizons, of soil that make up the soil. Soil horizons are typically classified based on their physical, chemical, and biological properties, and they can vary in thickness and composition depending on factors such as climate, vegetation, and the underlying geology.

Some common soil horizons include the surface horizon, the subsoil, and the parent material.

Learn more about soil horizon, here:

https://brainly.com/question/2416348

#SPJ5

What is carrying capacity? What factors could influence the carrying capacity of a population?

Answers

Answer:

Carrying capacity can be defined as a species' average population size in a particular habitat. The species population size is limited by environmental factors like adequate food, shelter, water, and mates. If these needs are not met, the population will decrease until the resource rebound

Humans have increased the world's carrying capacity through migra:tion, agriculture, medical advances, and communication. The age structure of a population allows us to predict population growth. Unchecked human population growth could have dire long-term effects on our environment.tion

Transcribe the following Strand of DNA:
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Answers

Answer:

CCGATAGGT

Explanation:

got this for my hw.

Answer:

So the central dogma of molecular biology describes the journey from DNA to protein product:

DNA --transcription--> mRNA --translation--> Protein

Assuming the DNA sequence provided is the template strand (rather than the complimentary coding strand), we start by transcribing the sequence into mRNA starting on the 3' end of the DNA towards the 5' end (which would build the mRNA 5' to 3'). This process involves the enzyme "RNA polymerase," which can only add nucleotides to the 3' end of the mRNA, just like how DNA polymerase can only synthesize DNA in the 5' to 3' direction. The RNA polymerase will bind to the template DNA strand and synthesize the complimentary mRNA, substituting uracil for thymine (since RNA does not contain thymine like DNA).

In terms of transcribing the sequence given to you, we'll have to work backwards + flip it around to get the 5' to 3' mRNA since the DNA is given 5' to 3' rather than 3' to 5'. Due to the length and the fact that we'll have to use triplets in translation anyways, it can help to break the sequence into triplet codons now.

5’-AAG | TTA | ATG | AGA | AAT | CGA | CAT | GGG | GCG | CCG | AAA | GTA | TAA | CCG | TCT | TAG | AAT | AGC-3’

We can then cross out each codon as we transcribe it and flip the sequence to be 5'-3' mRNA:

mRNA: 5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Normally, mRNA sequences start with "AUG" which is the start codon (and codes for Methionine), but I'll assume this is just for practice translating + transcribing in general. There's also a stop codon before the end but I'll assume the same again.

Translation involves three main steps - initiation, elongation, and termination. Initiation involves the translation ribosome assembling around the mRNA starting at the 5' end start codon, and tRNA carrying an amino acid binding to the complimentary section of the mRNA. As each tRNA attaches and the ribosome moves along the mRNA, the amino acids on each tRNA are bonded into a longer and longer peptide chain and the now amino acid-less tRNA are ejected (elongation). Termination occurs when a stop codon is reached, the ribosome will end elongation and help fold the protein into its final structure.

To translate the mRNA sequence here we'll need an amino acid/mRNA codon chart. I don't believe I can attach an image here, but looking up those exact words should yield the right results in images.

5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Ala - Ile - Leu - Arg - Arg - Leu - Tyr - Phe - Arg - Arg - Pro - Met - Ser - Ile - Ser - His - STOP - Leu

Amino acids are often abbreviated into three letters (Ala = alanine, Met = methionine, etc), and sometimes are abbreviated as single letters, though I've only seen that for sequencing databases.

In terms of locations for each of these processes, transcription occurs in the nucleus for eukaryotes and translation in the ribosomes/cytoplasm.

Explanation:

n

What is limestone?**

Answers

Answer: a hard sedimentary rock, composed mainly of calcium carbonate or dolomite, used as building material and in the making of cement.

Limestone is a sedimentary rock made of calcium carbonate (CaCO3), composed mainly of calcium carbonate or dolomite, used as building material and in the making of cement.

I don’t understand help

Answers

Answer:

A

Explanation:

not 100% sure but it seems to be the only sensible answer

what is the person's ultimate search in life? why?​

Answers

Answer: The ultimate purpose of life is to be at a higher positive frequency than negative, as you move through the vicissitudes of life, such that you feel content at the moment of death.

Contentment at the moment of death ensures that you reconnect to your positive soul self after death, review soul lessons, heal and recuperate.

If you are not content at the moment if death , you may get lost in an invisible maze of difficulties, as a spirit in a human form and gave a difficult after life & /or next life. .. To be content at the moment of death requires several years of training in detachment, meditation and positive thinking, through life.

Explanation:

Which forest biome has year-round
precipitation in many forms, is very
diverse with deciduous trees,
flowering trees, and shrubs, and
abundant growth in spring?
A. Temperate forest
B. Coniferous forest
C. Tropical rainforest
D. Tropical dry forest

Answers

Answer:

Due to their global position, temperate forests generally receive about 75-150 cm of precipitation every year.

Explanation:

(That's a lot, second only to the Tropics).

А____is a quantity that has magnitude and direction

Answers

Answer:

Vector

Explanation:

current definition

please help​

Answers

Answer: now or like presently

Explanation:

I dont know

Whats atoms are found in human fat?

Answers

Fatty acids are constructed from the chemical elements carbon, oxygen and hydrogen. Fatty acids can be divided into a carboxylic acid head group–hence fatty acid–linked to a long chain of carbon atoms.

does that help?

HELP ME!!!!

how did the psalmist express his awe and thanksgiving to god for his abiding presence and love for him?​

Answers

The Psalmist expresses his awe and thanksgiving to God for his affection by continually singing Him songs of praise.

The simplest way to thank God is to see Him everywhere and appreciate His presence in our life. It's important for us to remember that we are living because of Him.

The Psalms contain powerful quotes for giving thanks and finding blessings. Psalms 1 - 150 showed how the Psalmist was thanking God by singing praises to Him. The unifying theme of Psalms is praise for God.

Learn more about Psalms on:

https://brainly.com/question/2998438

In nature why do sediments settle from water? The water must blank or blank

Answers

Answer:

These benefits occur due to sediment deposition – when suspended particles settle down to the bottom of a body of water. This settling often occurs when water flow slows down or stops, and heavy particles can no longer be supported by the bed turbulence.

Answer:

because they are soft

Explanation:

and that why they swim

scientific question about a monkey

Answers

Did we get our way of think through monkeys or spontaneously?
This ones weird but did man come from monkey?

Plant and animal cells are both eukaryotic. This means they...
O Have a nucleus
O Contain DNA and RNA.
O Can reproduce on their own.

Answers

the answer is the first one they both have a nucleus!

Why long cell easily go through the cell

Answers

Answer:

Cells divide for many reasons. For example, when you skin your knee, cells divide to replace old, dead, or damaged cells. Cells also divide so living things can grow. ... Organisms grow because cells are dividing to produce more and more cells

Describe the structure and function of areolar connective tissue.

Answers

Answer:

Areolar Tissue is loose connective tissue that consists of a meshwork of collagen, elastic tissue, and reticular fibres - with many connective tissue cells in between the meshwork of fibres. The fibres that form the mesh structure of areolar tissue include: Collagen Fibres.

which fungus does contain mycelium?​

Answers

Answer:

Mycelium is part of the fungi kingdom and is the network of threads, called hyphae, from which mushrooms grow. Not all mycelia fruit mushrooms, depending on the environmental conditions, but all mushrooms come from mycelia.

Explanation:

Abagnale's life could best be paraphrased as...​

Answers

Answer:

running from the law and later working for  the law.

Explanation:

Frank Abagnale Jr. is the clear example of a boy who makes mistakes when trying to progress quickly without caring about his crimes, among which are the falsification of documents and checks, as well as the illegal practice of professions, which is why which during his youth had to flee from justice, however, due to the expertise he obtained after creating many false checks and his criminal journey, the American government gave him the possibility of working with them, contributing his knowledge of possible techniques fraud and help counter it, which was paradoxical considering his background.

How do protozoa and algae differ?

Answers

algae makes their own food while protozoa just digest things
Other Questions
Hire Refrigeration company floated Rs. 3 Billion bond on July 1, 2016. Each bond having face value of Rs. 1,000. Maturity of bond is 5 years, while interest coupon rate is 12%. What will be the value of bond if market interest rate is 8% and 15% respectively. Also what will be the new value of bond after 2 years if the market interest rate remains constant. A parabola can be drawn given a focus of (4,6) and a directrix of y = 2. What can besaid about the parabola? Fill in the blank with the correct form of crire in the present tense.Ilsune lettre leur ami.OA. criventB. crivonsC. crisO D. crit Read the text The History of Ice Cream:(1) I scream, you scream, we all scream for ice cream! Who doesn't love a nice, cold scoop of ice cream on a warm day? For thousands of years, ice cream has been a decadent dessert loved by most people around the world.(2) There is some argument about who first invented ice cream. Some believe that ice cream was invented by the Chinese people anywhere from 2,000 to 6,000 years ago. They created a recipe of frozen milk and rice that was served as a dessert. Persia has also been credited with first serving frozen desserts. Over 2,000 years ago, the wealthy people of Persia enjoyed shaved ice from the mountains, covered with grape juice. They later learned to freeze rosewater and add different fruit toppings. These desserts were considered delicacies that only the richest families could experience. About 1,000 years after this, there is evidence that suggested Nero, the Roman Emperor, also enjoyed frozen treats and demanded that a constant supply of ice from the mountains be available to him. He liked to add honey to the top of his dessert.(3) Ice cream as we know it can be traced back to the 9th century in Arab cities, such as Baghdad, Damascus, and Cairo. Near the end of the 13th century, Marco Polo returned to Italy after his travels through China with news of a frozen creamed dessert. In Europe, ice cream could only be found in Italy. Then, in 1533, Italian noblewoman Catherine de'Medici of Italy married Henry II of France. As Queen, Catherine introduced ice cream to France. Soon, the popularity of the dessert spread across all of Europe.(4) The first recorded account of ice cream in the United States was in 1744. In a written letter, a guest of Maryland Governor William Bladen detailed a delicious frozen dessert featuring strawberries and milk. The invention of electricity and manufacturing meant that ice cream could be made and kept much more easily, and the popularity of the frozen treat grew quickly across the country.(5) To start, ice cream was served in a dish. It wasn't until the late 19th century that the ice cream cone made its first appearance. As with ice cream itself, there has always been some controversy over who the true inventor of the ice cream cone was. It is claimed that in 1896, a man by the name of Italo Marchiony invented the ice cream cone in New York City. He was granted a patent for this cup-shaped invention in 1903. Then, in 1904, ice cream was served in a true conical-shaped cone by Ernest Hamwi at the St. Louis World Fair. Whoever the true inventor was, the discovery caught on, and by 1924, Americans were eating over 200 million ice cream cones a year!Read the text "How Ice Cream Is Made":Ice cream is a frozen blend of sweetened cream and air with added flavoring. This is how it is made commercially.Necessary Ingredients:Dairy products, including milk, cream, and butter fatSugarEggsFlavoringApproved additives to prevent ice crystals during production processProduction Steps:Step 1: To start, the ingredients are carefully measured and then combined together. The dairy ingredients, solids, and additives are blended well to ensure the liquid and dry components are completely mixed.Step 2: Next, the mix is pasteurized. This means it is heated to high temperatures to remove any bacteria which could be found in the raw ingredients. Pasteurization can occur at 155F for 30 minutes or 175F for 25 seconds. The temperatures used to pasteurize ice cream need to be higher than those used for milk because the mixture includes high-fat dairy sources, sweeteners, and egg yolks.Step 3: Following pasteurization, the ice cream mix is homogenized. This occurs when the fat globules in the cream are broken down into smaller parts through vigorous mixing. Once homogenized, the ice cream should be very smooth and uniform, meaning free of bubbles. Now the ice cream will be easier to whip and will not melt as fast.Step 4: The next step is to let the ice cream mixture stand for at least four hours. During this time, the fat cools and forms crystals.Step 5: A special barrel freezer is then used to gradually freeze the ice cream. The machine also pumps clean air into the mix. This keeps the ice cream soft and allows it to absorb the different flavorings. Without the air, the mixture would become as hard as an ice cube.Step 6: During freezing, flavoring can be added. Ice cream flavors have moved on from plain vanilla and chocolate to include hundreds of combinations using fruit, nuts, candy, cookies, and other baked goods.Step 7: Finally, the ice cream is packaged and put into a blast freezer where the temperature is between -22 to -40 Fahrenheit.How does paragraph 4 of The History of Ice Cream relate to Step 7 of "How Ice Cream Is Made"? How do you say "The" in Spanish Singular: Plural:Masculine: _______ _________Feminine: ________ __________ What is the minimum hot holding temperature requirement for macaroni and cheese. I need help of these questions please and thank you! ANSWER ASAP WILL MARK BRAINLIEST Explain how the graphic organizer helped you formulate your decision and participate in the discussion. 1/2(10p-7q) if p=9 and q=2 Which of the following is best used to measure the amount of time that has passed in your lifetime? (A)minutes (B)seconds (C)days(D)years Find the heat given off if 1 kg of 125 degree C steam is cooled to 50 degree C water. a waist circumference _____ inches for men and _____ inches for women indicates increased risk of disease. 2. In a class 70 students, 44 like Bookkeeping, 36 like- Commerce, and 17 like both bookkeeping and commere How many student like both book keeping and commerce? 1.0835 rounded to the nearest tenth what was one effect of the columbian exchange on the americas during the colonial era? how to calculate modulus of rigidity from stress strain curve 2BClue #4Each letter corresponds to a number, and vice versa.Try to figure out the phrase by guessing the missing letters.17-|||| | DF416 18-GH16o18 14 12151JKLHM211416 12N18ODOZM13181221RS20131832511 18 25TUCVCs ?W1512 171 -114 12 20Y25N Pls help with at least one and explain how u solved it so I can do the rest myself Please help me no links or bots please and thank you please actually help me with this please