Wind blowing rocks together forming smaller rocks

Answers

Answer 1

Answer:

weathering

Explanation:

weathering is the breaking down of the rock,

erosion is the movement of sediment from broken rocks

deposition is the dropping of a sediment in a new place

in your case, I would say weathering because the wind is breaking down the rock and it is the first form of the cycle

hope this helps!


Related Questions

Double stranded RNA is cleaved by

Answers

Answer:

Dicer

RNA-dependent RNA polymerase amplifies siRNAs by binding to them and making more dsRNA, which is recognized and cleaved by Dicer into secondary siRNAs. The result is the silencing of genes by amplifying the RNAi effect. In certain cases RNAi also silences genes by the formation of heterochromatin.

Why is the metric system more scientific than the English system?


A. The English system is older than the metric system, and so it is less relevant.


B. The English system is only used in English-speaking countries.

C. The English system was based on human traits, while the metric system was founded on physical constants.


D. The English system must be converted to the metric system using conversion factors.

Answers

Answer:

Unlike the British Imperial System, the metric system, or SI (from the French Système International), is based on a natural constant.

Explanation:

The metric system is more scientific than the English system because the English system was based on human traits, while the metric system was founded on physical constants.

What do you mean by the Metric system?

The metric system may be defined as the scientific way of measuring weights, and distance in kilograms and meters respectively with the help of a decimal system.

The metric system may also be known as the SI system. SI system is not based on the human traits rather then it depends on the natural constant. It is more precise, standard, and easy to understand.

Therefore, the correct option for this question is C.

To learn more about the Metric system, refer to the link:

https://brainly.com/question/1576704

#SPJ2

The population of mice in a local forest ecosystem has recently died out due to disease. In the past, these mice made up a large part of the diet of the forest fox.

What is the best prediction about what will happen to the foxes?

Answers

As their main source of food has died out through the course of time the forest fox will have a harder time finding different prey causing them to die

PLS HELP, HELP HHHHEEEELLLLPPPP
1) How long is it's growing season for carrots.
2) How long is it's growing season for corn.

Answers

Answer:

2-4 months for carrots and about 120 days for corn

Explanation:

In which part of the male reproductive part do pollens found? A. Anther B. Filament C. Stigma D. Style​

Answers

Answer:

Anther

Explanation:

Stamen is a male reproductive part in which anther produce male reproductive cells.

Answer:

The stamen is made up of two parts: the anther and filament. The anther produces pollen (male reproductive cells). The filament holds the anther up. During the process of fertilization, pollen lands on the stigma, a tube grows down the style and enters the ovary.

Explanation:

This is confusing, help please

Answers

Answer:

C: the song bird

Explanation:

Birds follow a type II or in your case a type B survivorship curve. Unlike elephants which are a Type I or Type A, and the bugs are Type III or Type C in your case.

Answer: I think it would be (C)

Explanation:

I really hope this helps

What is the name of the disease caused by a lack of thyroid hormones?​

Answers

Thyroiditis.Graves' disease.Hashimoto's disease.Goiter.Thyroid nodule.Thyroid cancer.

A dowry is:
A.
Money or property given by a man to or for his bride
B.
A gift given by the bride to her mother-in-law
C.
Money or property given by a man to his parents
D.
Money or property given by the bride to her parents

Answers

Answer:

B

Explanation:

As dowry system is the social problem in which the bride/bride's family has to give money or property to the groom's family.

The bride/bride's family has to give money or property to the groom/groom's family on their marriage.

It’s A not B it’s given by the husband to be

Isabel is researching the effects of deforestation using online sources. She finds an environmental study on the relationship between deforestation and local weather. Which of the following characteristics should this study have in order for its results to be considered valid?

I. Empirical observations
II. Evidence that can be replicated
III. Outcomes that don't change with new experimentation

A. I and II
B. II and III
C. I and III
D. I only

Answers

Answer:

Here is something that might help you

Explanation:

I am not trying to plagiarize, just trying to help.

Learn more of where I got this answer at https://brainly.com/question/24430205?referrer=searchResults. Trust me, it is not a site that will steal any of your information, phone numbers, or passwords. I hope I helped.

Which statement best describes energy release in cellular respiration? (1 point)

Stored chemical energy is broken down and released in the cytoplasm.
Stored chemical energy is broken down and released in the cytoplasm.

Stored chemical energy is broken down and released in the mitochondria.
Stored chemical energy is broken down and released in the mitochondria.

Stored chemical energy can be used immediately and is released in the cytoplasm.
Stored chemical energy can be used immediately and is released in the cytoplasm.

Stored chemical energy can be used immediately and is released in the mitochondria.

Answers

Answer:

During cellular respiration, glucose is broken down in the presence of oxygen to produce carbon dioxide and water. The energy released during the reaction is captured by the energy-carrying molecule ATP (adenosine triphosphate).

So the answer is Stored chemical energy is broken down and released in the mitochondria.

Explanation:

In cellular respiration, stored chemical energy is broken down and released in the mitochondria. The correct option is B.

What is mitochondria?

Mitochondria are the membrane-bound organelles that create the maximum of the chemical energy necessary to power the biochemical reactions of the cell.

The mitochondrial energy is stored in a small molecule referred to as adenosine triphosphate (ATP).

Cellular respiration is the way by which organic fuels are oxidized in the presence of an inorganic electron acceptor, encompassing one as oxygen, to give enormous amounts of energy and pressure the majority production of ATP.

Cellular breathing is the way by which cells in plants as well as animals break down glucose and convert it into power, which is then used to perform work.

The goal of cellular respiration is simple: to provide the energy that cells require to function.

Thus, the correct option is B.

For more details regarding cellular respiration, visit:

https://brainly.com/question/13721588

#SPJ5

b) Give an example of an animal with radial symmetry and an example of an animal with bilateral
symmetry. (2 points)

Answers

Answer:jellyfishes, corals, anemones, and ctenophora.

Explanation:

Examples of animals that possess bilateral symmetry are: flatworms, common worms ("ribbon worms"), clams, snails, octopuses, crustaceans, insects, spiders, brachiopods, sea stars, sea urchins, and vertebrates.

What is a long chain of one-ring sugar molecules?

Answers

Answer:

polysaccharide

Explanation:

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

What is Not a correct statement about chromosomes,Dna,or genes

Image below

Answers

A. Genes have the code that make protein

what is the effect of atmospheric disturbances on stars

Answers

This the correct answer

Explanation:

However,when light enters the Earth's atmosphere,the different wind speeds distort the light waves,leading to distortions in the image of stars.The effects of the atmosphere can be modeled as rotating cells of air moving trubulently.

#carryonlearning

#brainlyeveryday

#ctto

thrips are insects that feed on rose

Answers

Answer:

????????????????????????

1. Which of the following characteristics is possessed by invertebrates?
a) exoskeleton
b) endoskeleton
c) joint appendages
d) cephalization

Answers

Answer: a) exoskeleton

Explanation:

Well, many invertebrates – and all arthropods – have a protective external casing called an exoskeleton. This literally means ‘outside skeleton’ and its role is to cover the animal’s soft tissues and also provide a rigid structure to which the creature’s muscles can attach.

Show you work here using the data table 1 to calculate the energy consumed by this female sea otter.

Answers

Answer:

the female sea otter has 1

Explanation:

You are working with a population of snails. During the mating season, you observe that individuals in the population will only mate with others of the same genotype. For example, Mm individuals will only mate with Mm individuals, and mm individuals will only mate with other mm individuals. There are only two alleles for this gene (M is dominant; m is recessive). You have determined that the frequency of the M allele is 0.5. After one generation, what is the expected genotype frequency for Mm individuals in this population

Answers

If matings are not random in a population and individuals mate with other individuals of similar genotype/phenotype, h0m0zyg0us frequencies increase. In this example, the genotype frequency for Mm is F(Mm) = 0.25.

---------------------------------

In the exposed example, one of the assumptions of Hardy-Weinberg equilibrium is not accomplished. There are non random matings.

Individuals mate with other snails of the same genotypes

MM  x  MM

Mm  x  Mm

mm  x  mm

We can assume this is an example of matings by similar phenotypes.

Eventually, this mating system leads to an increase in the h0m0zyg0us genotype frequency, at the expense of heter0zyg0us ones in loci that determine the trait.

Allelic frequencies do not change. Only genotypic frequencies do.

This mating system tends to separate the population into two subgroups, decreasing the amount of heter0zyg0us individuals.

          Matings              Progeny                              

MM  x  MM         4/4 MMMM  x  Mm         1/4  MM + 2/4 Mm + 1/4 mmmm  x  mm         4/4 mm

Zygotic population of the next generation

F(MM) = 4/4 MM + 1/4 MmF(Mm) = 1/2 MmF(mm) = 4/4 mm + 1/4 Mm

So, in the exposed example we know that the frequency of the dominant allele M is 0.5

f(M) = p = 0.5

knowing that p + q = 1, we can clear the equation to get the frequency of the recessive allele.

p + q = 1

0.5 + q = 1

q = 1 - 0.5

q = 0.5

f(m) = q = 0.5

Zygotic population of the next generation

F(MM) = 4/4 MM + 1/4 Mm

       F(MM) = p² + 1/4 (2pq)

       F (MM) = 0.5² + 1/4 (2 x 0.5 x 0.5) = 0.25 + 0.125

       F(MM) = 0.375

F(Mm) = 1/2 Mm

        F(Mm) = 1/2 (2pq)

        F(Mm) = 1/2 (0.5)

        F (Mm) = 0.25

F(mm) = 4/4 mm + 1/4 Mm

        F(mm) = q² + 1/4 (2pq)

        F(mm) = 0.5² + 1/4 (2 x 0.5 x 0.5) = 0.25 + 0.125

        F(mm) = 0.375

The expected genotype frequency for Mm individuals in this population is F(Mm) = 0.25.

------------------------------

You can learn more about mating systems at

https://brainly.com/question/13007693?referrer=searchResults

https://brainly.com/question/19186330?referrer=searchResults

https://brainly.com/question/15737843?referrer=searchResults

the role of dna in cellular differentaation

Answers

Answer:

controls the way cells function, also determines what type of specialized cells will be made.

Question 7(Multiple Choice Worth 2 points) (06.02 MC) Read the two sentences. The boy scored the winning goal is on my team. name is Greg. Select the words that complete the sentences. o . that. His that. Their O who. His who. Their​

Answers

Answer:

The boy that scored the winning goal is on my team. His name is Greg.

Explanation:

If a firm hires 10 workers at $9 per hour each and the 11th worker will be hired only if the wage rate falls to $8 per hour, the marginal wage rate must be _____.

Multiple Choice
−$2
$2
−$2.20
$2.20

Answers

Answer:

-2 USD

Explanation:

The answer is -$2.20

A leech attaches to an animal and feeds off the animal's blood.

What happens to the animal the leech attaches to in this scenario?

It loses nutrients to the leech.
It gains nutrients from the leech.
It will be killed and eaten by the leech.
It will kill and eat the leech.

Answers

Answer:

Explanation:

A

Answer: [A] It loses nutrients to the leech.

Explanation:

need help with the top question :p

Answers

Which of the following is the best explanation
for the presence of both chloroplasts and
mitochondria in plant cells? - If plants cannot
produce enough ATP in the process of
photosynthesis to meet their energy needs,
they can produce it in aerobic respiration.
Sugars are produced in chloroplasts.

Which of these forms when air moves in the directions shown by the arrows
in the diagram?

A ) Valley Breeze
B) Land Breeze
C ) Mountain Breeze
D ) Sea Breeze

Answers

Answer:

C.

Explanation:

Please do brainless :)

Mountain breeze refers to the fact that the surface breezes are coming from the mountain and blowing into the lowlands. Thus, option C is correct.

What is the movement of air in mountain breeze?

The air cools during the night and flows into the valley from the mountainside.

As a result, the breeze blows in the other direction; it travels from the mountains to the plains and valley floor. This wind is therefore referred to as the mountain breeze.

As the air rushes in to fill the space, the air pressure decreases and a gust of wind is produced. A valley breeze, on the other hand, develops when cooler air in the valley falls to fill the space left by the warm air rising.

Therefore, Mountain Breeze in which air move from high pressure to low pressure.

Learn more about mountain breeze here:

https://brainly.com/question/12997458

#SPJ5

Fill in the blanks below with the correct word to complete the sentence.
Water is warmed by the sun and

It is then cooled and
Finally, it is brought back to Earth in the form of

Answers

Answer:

Evaporates, Condensed, Liquid Water

Explanation:

Water is warmed by the sun and evaporates

It is then cooled and condensed

Finally, it is brought back to Earth in the form of Liquid Water

Answer:

Fill in the blanks below with the correct word to complete the sentence.

Water is warmed by the sun and evaporate

.

It is then cooled and condensation

.

Finally, it is brought back to Earth in the form of

Water

⇒ precipitation.

Explanation:

got it right 9/23/22

what is colustrum? explain plz​

Answers

Colostrum is the first stage of breast milk. It develops during pregnancy and lasts for several days after birth. Colostrum is yellow and thick in consistency or can appear clear and runny. Babies need small amounts of food, and the mother’s colostrum is perfect in components and volume.

Which of the following is NOT considered a form of precipitation? *
Rain
Snow
Lightning
Hail
All of the above are considered precipitation

Answers

Answer:

Lightning is not considered a form of precipitation but rather a discharge of electricity.

An antibody is a foreign substance in the body.
a. True
b. False

Answers

Answer is B. False :)

Giving Away 50 points + brainy to first



Ava has been reading about the interactions among the components of the Earth. This group of components work together to make a/an ____

Answers

Ava has been reading about the interactions among the components of the Earth. This group of components work together to make a system.

The group of components of the Earth work together to make an environment we live in.

What are the different components of the Earth?

The interactions between Earth's five systems—the geosphere, biosphere, cryosphere, hydrosphere, and atmosphere—create the environment we are accustomed to.

The Earth's interior and surface, which are both formed of rocks, make up the first system, the geosphere. The second system is made up of the little area of the planet that may sustain life; this area is known as the biosphere. The third system contains the hydrosphere, or regions of Earth that are completely covered with water. The fourth system is the atmosphere, a gaseous envelope that maintains the planet's temperature while also supplying carbon dioxide for photosynthesis and oxygen for breathing. The cryosphere, which is composed of enormous amounts of ice in the poles and elsewhere, is the fifth system. The maintenance of the Earth as we know it depends on the interaction of all five of these vast and intricate systems.

Learn more about Earth's component, here:

https://brainly.com/question/11250595

#SPJ5

Other Questions
83 devided by 3, with remainders PLEASE ANSWER ASAP!! WORTH 20 POINTSA cab company charges a $4 boarding rate in addition to its meter which is $1.50 for every mile. Write a linear equation which models this. Use the equation to determine the total fare for a trip that is 2 miles, 3 miles and 5 miles. Definition for starch in science ? Depth perception is also known as ___________ vision. Write ratios in the form 1:n or n:1 6 : 14 why unfavorable traits do not usually get passed to offspring? No links please tuberculosis is a disease caused by slow growing bacteria that The following table was made to compare rocks and minerals. What information in the table needs to be corrected?A. Rocks do have specific chemical compositions and minerals do not have specific chemical compositions.B. Rocks include granite and marble, minerals include quartz and diamond.C. Rocks do have specific chemical compositions and minerals do as well.D. Rocks include quartz and diamond, minerals include granite and marble. What is Revenue?What is Expense? How do we know that some pattern, rhythm, or meter was present in some of the Psalms?Many psalms were sung.The first line of the Psalm states the pattern.Many musical words and notes are used in the psalms.Rhythm is detected when a psalm is read aloud. 5) The Barnett triplets went to the school carnival. Henry rode on 5 rides, bought 2 drinks, 1 bag of popcorn andspent $20.50. Mary spent $16.50 on 3 rides, 3 drinks and 1 bag of popcorn. While Tim rode on 6 rides onlypurchased 1 drink and spent $20.00. How much did each ride cost?a.$12b. $3C. $2d $4PLEASE HURRY2 Which type of effort to preserve species do youthink is most worthwhile? Explain how scientists can have multiple theories about the effects of global warming.Plz make it about 3 sentences Which country made money through the fur trade and land? One whale sang to communicate with another whale. The song's sound wave traveled 2,100meters at a steady speed in 1.4seconds. What was the sound wave's speed? what is -4(2x - 3) equal 9. P waves move faster than S waves A. True B. False Marks friends told him about an automated program that sends unsolicited messages to multiple users. Which type of program were Marks friends referring to? Please help with this!! 2. What substances travel in the Xylem of flowering plants?