You’ve learned to identify whether a function is even or odd both graphically and algebraically. How does the notation for reflections over the x-axis and over the y-axis relate to the notation for even and odd functions? Remember that if f(-x) = f(x), a function is even, and if f(-x) = -f(x), then the function is odd.

Answers

Answer 1

Answer:

Because even and odd are 2 different ways to determine whether or not you get the right answer for the chosen function.

Step-by-step explanation:

Hope this helps!!!

Answer 2

Answer:

For even functions, we take f(-x) to be the starting function. The y-axis reflection of this function is f(-(-x)), which is equal tof(x). So the relationship f(-x) = f(x) means that the function is the same as its y-axis reflection.

For odd functions, there are two reflections that must occur. First, we start with f(-x). The y-axis reflection of this function is f(-(-x)) = f(x). When we apply an x-axis reflection to this result, we get -f(-(-x)) = -f(x). So the fact that f(-x) = -f(x) means that odd functions are the same as sequential reflections across both the x-axis and the y-axis. (The same sequence of reflections also represents a rotation 180 degrees about the origin).

Step-by-step explanation:


Related Questions

I need help finding an eqaution for this. Thank you in advanced

Answers

Answer:

Formula: [tex]c=\frac{sale\ price\ of\ 7}{7}+\$0.75[/tex]

Normal Price: [tex]\$1.15[/tex]

Step-by-step explanation:

First, you have to find the current price of one cookie.

Since 7 cookies cost $2.80, then the price for one sale price cookie would cost

Then you would have to add the $0.75 to the sale price to get the normal price.

[tex]\$0.4\ +\ \$0.75=\$1.15[/tex]

The normal price of a cookie would be $1.15.

The formula to get that answer would be:

[tex]c=\frac{sale\ price\ of\ 7}{7}+\$0.75[/tex]

Hope this helps!

q = d / d+ n on a manufacturer's assembly line, d parts are found to be defective and n parts are nondefective. the formula above is used to calculate a quality-of-parts ratio. What is d expressed in terms of the other two variables?

a. n / 1 - q
b. nq / 1 - q
c. n / q-1
d. nq / q-1

Answers

Answer:

d. nq / q - 1

General Formulas and Concepts:

Pre-Algebra

Equality Properties

Algebra I

Factoring

Step-by-step explanation:

Step 1: Define

q = d / (d + n)

Step 2: Solve for d

Multiply (d + n) on both sides:                    q(d + n) = dDistribute q:                                                 dq + qn = dSubtract qn on both sides:                         dq = d - qnSubtract d on both sides:                           dq - d = -qnFactor GCF:                                                 d(q - 1) = -qnDivide (q - 1) on both sides:                        d = -qn / (q - 1)Rearrange:                                                   d = nq / -(q - 1)Distribute -1:                                                 d = nq / 1 - q

What is the equation of this line

Answers

Answer:

Y= 2x

Step-by-step explanation:

Two points in that graph are (1,2) and (2,4). you have to do rise over run so 4-2 over 2-1 and the answer is 2/1 or just two.

What is the distance between (-5, 2) and (-9,-4)?
Leave your answer in simplest radical form.

Answers

Answer:

[tex]2\sqrt{13}[/tex]

Step-by-step explanation:

Use the distance formula.

[tex]d = \sqrt{(-9+5)^2+(-4-2)^2} = \sqrt{(-4)^2+(-6)^2} = \sqrt{16+36} = \sqrt{52} = 2\sqrt{13}[/tex]

The distance between (-5, 2) and (-9,-4) is 7.211 units.

What is distance?

The complete movement of an object, regardless of direction, is referred to as distance. The amount of ground a thing travels from its starting point to its destination is also referred to as distance.

Given:

The coordinates of the point (-5, 2) and (-9,-4).

Calculate the distance using the formula given below,

[tex]d = \sqrt{(x_2 - x_1)^2+(y_2-y_1)^2}[/tex]

d = [tex]\sqrt{[(-9) - (-5)]^2 +[(-4-2)]^2 }[/tex]

d = [tex]\sqrt{-4^2+(-6)^2}[/tex]

d = [tex]\sqrt{16+ 36}[/tex]

d = 7.211 units

Therefore, the distance between (-5, 2) and (-9,-4) is 7.211 units.

To know more about distance:

https://brainly.com/question/15256256

#SPJ2

What is the solution to the equation ? (x - 2) ^ (1/2) + 4 = x

Answers

Answer:

x is equal to both 3 and 6.

Step-by-step explanation:

[tex]\sqrt{x - 2} + 4 = x\\\sqrt{x - 2} = x - 4\\x - 2 = (x - 4)^2\\x - 2 = x^2 - 8x + 16\\x^2 - 9x + 18 = 0\\(x - 3)(x - 6) = 0\\[/tex]

So x values of 3 and 6 will make this statement true.

Which inequalities have no solution? Check all of the boxes that apply.
-3x <-3x
-4 + x>-2 + x
O X-2

Answers

Answer:

-3x<-3x and -4+x>-2+x are both false

Step-by-step explanation:

1) -3x = -3x; they are the same amount.

2) -4 + x > -2 + x

          -x          -x

    ----------------------

           -4 > -2

-4 > -2 is false because -2 > -4.

Does this table of values represent a linear relationship? Explain your answer.

Answers

Answer:

Yes

Step-by-step explanation:

Yes, because there is a constant rate of change. It is and will always be constantly increasing by 1.5.

To be a linear line you have to have a constant rate of change.

factor completely, I NEED HELP


4x^3 + 7x^2 +4x + 7

Answers

(4x+7) (x^2+1) is it factored

The common factor is x ^ 3

So that gives you x ^ 3 = (4+ 7  / x + 4 / x ^ 2 + 7 / x ^ 3)

Because we therefore simplify x ^ 3 = (4 + (7x ^ 2 / x ^ 3) + (4x / x ^ 3) + 7 / x ^ 3)

A recipe uses 5 cups of flour for every 2 cups of sugar.

How much sugar is used for 1 cup of flour?
How much flour is used for 1 cup of sugar?
How much flour is used with 7 cups of sugar?
How much sugar is used with 6 cups of flour?

Answers

Answer:

2.5

Step-by-step explanation:

5 divided by 2= 2.5

Answer:

2.5

Step-by-step explanation:

5x+10y=5 -13x+4y=17 NEED HELP
WILL MARK THE RIGH ANSWER BRAINLIEST

Answers

Answer:

I think x = 1 and y = 1/2. For the second: x = -1 4/13 or -1.307692, y = 4 1/4 or 4.25

Step-by-step explanation:

System of Linear Equations entered :

[1] 5x + 10y = 5
[2] -13x + 4y=17


Solve by Substitution :

// Solve equation [2] for the variable y


[2] 4y = 13x + 17

[2] y = 13x/4 + 17/4
// Plug this in for variable y in equation [1]

[1] 5x + 10•(13x/4+17/4) = 5
[1] 75x/2 = -75/2
[1] 75x = -75
// Solve equation [1] for the variable x


[1] 75x = - 75

[1] x = - 1
// By now we know this much :

x = -1
y = 13x/4+17/4
// Use the x value to solve for y

y = (13/4)(-1)+17/4 = 1
Solution :
{x,y} = {-1,1}

A bowling alley charges a one-time fee of $5.50 to rent shoes and $3.50 per game. Write an equation that represents "y", the total dollar amount that you must pay to bowl "x" games.
Please help this is due today, I would appreciate it if you did help!

Answers

Answer: 14$

Step-by-step explanation:

let x = number of games, let y = cost of shoe rental

then        Total cost = x•$4 + y

In this case, TC = 3•$4 + $2

TC = $14

Keith sampled 10 private universities in Colorado and recorded the tuition cost. Keith wants to test the hypothesis that the tuition of these 10 universities is more expensive than the national average tuition, which is $29,056 with a population standard deviation of $3,339.
z equals fraction numerator x with bar on top minus mu over denominator begin display style fraction numerator sigma over denominator square root of n end fraction end style end fraction

If the sample mean is $31,650, what is the z-score? Answers are rounded to the hundredths place.

Answers

Answer: The z-score = 2.46

Step-by-step explanation:

Given:  sample size : n= 10

Population mean : [tex]\mu= 29056[/tex]

population standard deviation : [tex]\sigma= 3339[/tex]

Sample mean : [tex]\overline{x} = 31650[/tex]

Formula to calculate z :

[tex]z=\dfrac{\overline{x}-\mu}{\dfrac{\sigma}{\sqrt{n}}}[/tex]

Substitute all values, we get

[tex]z=\dfrac{31650-29056}{\dfrac{3339}{\sqrt{10}}}\\\\=\dfrac{2594}{\dfrac{3339}{3.16227766}}\\\\=\dfrac{2594}{3339}\times3.16227766\approx2.46[/tex]

Hence, the z-score = 2.46

Which statement is true? 7.11≤−7.1 7.11>−7.1 7.11<−7.1 7.11=−7.1

Answers

Answer:

7.11 > -7.1

Step-by-step explanation:

A skirt was originally priced $32. It is on sale for $24. What percent is the discount

Answers

Answer:

25% off

Step-by-step explanation:

$32 is 100%. 8 dollars was taken away, and since 8 is 1/4 of 32, we can divide 100% by 4 to get 25%. 25% is $8

Answer:

25%

Step-by-step explanation:

24/32=0.75

100-0.75= 0.25

So 25% off.

Hope that helped! (ノ◕ヮ◕)ノ*:・゚✧

( ゚д゚)つ Bye

Ehehejejrjrjejejrjrjtjtjrjrje

Answers

Answer:

?

Step-by-step explanation:

shvwhehdjdjdnbddvbxnxjjxjdjdnbdnekskdjdjnebeeekekkenenennenemskkddkejennene hope this helps :3

Please answer A and B!!!

Answers

Answer:

7 and 2

Step-by-step explanation:

i did this before i know

What is the range of h

Answers

Answer:

The range of the function is the set of all possible outputs, that is, the set of all values obtained by applying the function to elements of the domain. So the set of all values which can be obtained by applying h(x) to an element of its domain is {−4,0,5,60} , and thus that is the range of h(x)

Step-by-step explanation:

GOOD LUCK

Find the average rate of change from x = 2 to x = 6 for the function f(x) = 3^x and select the correct answer below.

180
- 180
- 720
720​

Answers

Answer:  Choice A) 180

======================================================

Work Shown:

f(x) = 3^x

a = 2 = lower value of the interval

b = 6 = upper value of the interval

c = average rate of change of f(x) from a to b

c = ( f(b) - f(a) )/(b - a) ..... note how this mimics the slope formula

c = ( f(6) - f(2) )/(6 - 2)

c = ( 3^6 - 3^2 )/4

c = ( 729 - 9 )/4

c = 720/4

c = 180

The average rate of change from x = 2 to x = 6 for f(x) = 3^x is 180

I need help guys please help

Answers

slope=rise/run

rise: 7
run: 6

so it would be -7/6

(mark brainliest if right pls)

if p = x(3x+5) - 28, then p is divisible by which of the following expressions?

Answers

Answer:

o p is factorable by 3x - 7, and x + 4

Step-by-step explanation:

Let's factor it:

[tex]p = x(3x + 5) - 28\\p = 3x^2 + 5x - 28\\p = (3x - 7)(x + 4)[/tex]

So p is factorable by 3x - 7 and x + 4

Ryan's dog weighs 50 pounds, and Mark's dog weighs p pounds. Which expression shows their combined weight? A. 50 × p B. 50 + p C. 50 ÷ p D. 50 - p

Answers

Answer:

B, 50 + p.

Step-by-step explanation:

To combine their weight, you would add them together. B is the only answer that uses addition.

What is the slope and y intercept of this diagram

Answers

The Answer is 1/5 and 5

slope: 1/5 y-intercept: 5

WILL GIVE BRAINLIEST PLS HELP!!!!! - Which expression represents a cube root of –8?

Answers

Answer:

A

Step-by-step explanation:

Answer:

C or 2(cos(pi/3)+i sin (pi/3))

Write an equation of the line in slope intercept form (0,5)(3,4)

Answers

Find slope (y2-y1)/(x2-x1)
(4-5)/(3-0) = -1/3
Y = -1/3x + b
5 = -1/3(0) + b, b = 5
Equation: y = -1/3x + 5

The slope intercep equation of the following points  (0,5) (3,4) will be y = (-1/3)x + 5.

What is the slope-intercept equation?

A slope-intercept equation is the equation of the two variables x and y in which the form of the equation should be in such a way that it should contain the slope of the given equation.

For example, in the equation, y = mx + c here m will be the slope of the equation and this is the slope-intercept equation.

Another example is y = 3x + 7 here 3 will be the slope of that equation.

Slope m = difference in y coordinate/ difference in x coordinate.

Let's suppose our equation is y =mx + c

now m = (4 - 5)/(3 - 0)

m = -1/3 now for c put both point in the equation we get as 5.

So y = (-1/3)x + 5 will be correct slope intercept form.

For more information about slope intercept form

https://brainly.com/question/9682526

#SPJ2

Jack has the following scores on exams in his math class 81, 87 93, 89, 61 81 If he wants to make his performance sound as good as possible, which measure should he use the mean, the median, or the mode of his exam grades when he talks about how he is doing? Explain In you response, make sure to a calculate the mean, o calculate the median, and c calculate the mode of his exam grades D compare and pick the measure that makes his performance sound as good as possible. plz explain ​

Answers

Answer:

mean is 82, Median is 84, mode is 81  

Step-by-step explanation:

The mean of the given data set is 82, median is 84 and mode is 81.

The given data set is 81, 87 93, 89, 61, 81.

What is the median?

The median is the value that's exactly in the middle of a dataset when it is ordered.

Now, the ordered pair is 61, 81, 81, 87, 89, 93.

Median = (81+87)/2

=168/2

=84

Mean = Sum of all the observations/Number of observations

= (61 + 81 + 81 + 87 + 89 + 93)/6

= 492/6

= 82

Mode = The mode is the value that appears most frequently in a data set.

Here, 81 is the most frequently in the given data set.

Therefore, the mean of the given data set is 82, median is 84 and mode is 81.

To learn more about the arithmetic mean visit:

https://brainly.com/question/23706022.

#SPJ5

A U.S. government survey in 2007 said that the proportion of young Americans that earn a high school diploma is 0.87. a)Suppose you took a simple random sample of 100 young Americans. We know because of sampling variability that the sample proportion of those who earned a high school diploma would vary each time you took a sample. Assuming the value above can be taken as the population proportion (i.e. as a parameter), what model can be used to describe how these sample proportions would vary

Answers

Answer:

normal distribution can be used to model the sample proportions

Step-by-step explanation:

N ( sample size ) = 100

probability of earning high school diploma (p)  = 0.87

probability of not earning high school diploma ( q ) = 0.13

hence ;

∈( P ) = p = 0.87

Var ( p ) = [tex]\frac{pq}{n}[/tex]  = [tex]\frac{0.86 * 0.13 }{100}[/tex]  = 0.001131

therefore ; p ~ N = ( 0.87 , 0.001131 )

3. Tarzan went to the plant nursery and bought a tree that was initially 90 feet tall for his monkey friends to climb on.
After planting the tree, Tarzan made a table to record the height, h, of the tree, t years after it was planted. “Zero” is the time when he planted the tree.
t 0 1 2 3 4
h 90 105 120 135 150


(a) Use words to describe the relationship between the height of the tree and the number of years since it was planted.


(b) Write a two-variable equation to illustrate the relationship between the height of the tree and the number of years since it has been planted.

Answers

Answer:

ok im convuzed how do you buy a 90ft tree cuz that sounds fun

Step-by-step explanation:

pls lemme know

How long will it take for $5,000 to double at the rate of 2.25% interest?

Answers

Answer:

31.15

Step-by-step explanation:

Four customers at a grocery store are buying apples. The table shows how many pounds of apples each customer bought and how much each customer paid.
After the previous four customers, another customer, Timothy, spent $28.00 buying apples.
We can determine that Timothy bought ------------
of apples.
A: 11
B: 12
C: 14
D: 16

Answers

Answer is C: 14

Explanation:
On the image added, the pounds of apples is half the cost. So if you would keep that same relationship and add $28.00 to one of the costs the outcome would be 14

if x =20 and y =40 then x and y are

Answers

Answer:

Are directly proportional

Other Questions
Which subject and verb are in agreement? A. Chefs/cooksB. Cars/drive C. Student/sitsD. Flowers/grow A tropical punch recipe calls for 300 ml of sugar for every 222 flavor packages. Write an equation that shows the relationship between s, the amount of sugar in milliliters, and f, the number of flavor packages for this recipe. The gustatory system is the sensory system that deals with smell. True or False Help please. Thank you. solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons. one of u guys helped me but they keep returning it saying show your work>:( how do you find the area of a triagnle and a rhombus in gerneral