10. If the red allele is incompletely dominant to the white alle
individual's phenotype be?

Answers

Answer 1
If RR Is red, and rr is white, Rr is pink. Incomplete dominance is a mixing of traits.

Related Questions

Many livestock are being grazed on public lands because the fees to graze on public lands are cheaper than the fees for private lands. If we aren't careful, what can this cause? A. owners moving their livestock TO private lands B. increased fees for private lands C. overgrazing on public lands D. overgrazing on private lands​

Answers

Answer:

I would say that this would cause "overgrazing on public lands."

Explanation:

When people see that the fees are cheaper, they would send their livestock there. It might be alot of livestock though

Which phrase best describes what a soil horizon is?
A the bottom layer of a soil profile
B each layer of a soil profile
C the place where two soil profiles meet
D the place where a soil profile meets bedrock​

Answers

Answer:

I suppose the answer is C

Each layer of a soil profile best describes a soil horizon.

What is a soil horizon?

A soil horizon is a layer of soil within a soil profile. A soil profile is a vertical section through the soil, showing the different layers, or horizons, of soil that make up the soil. Soil horizons are typically classified based on their physical, chemical, and biological properties, and they can vary in thickness and composition depending on factors such as climate, vegetation, and the underlying geology.

Some common soil horizons include the surface horizon, the subsoil, and the parent material.

Learn more about soil horizon, here:

https://brainly.com/question/2416348

#SPJ5

In nature why do sediments settle from water? The water must blank or blank

Answers

Answer:

These benefits occur due to sediment deposition – when suspended particles settle down to the bottom of a body of water. This settling often occurs when water flow slows down or stops, and heavy particles can no longer be supported by the bed turbulence.

Answer:

because they are soft

Explanation:

and that why they swim

Do you think people should be able to patent DNA? Should people have the right to trademark their own DNA? Explain why or why not.

Answers

Yes because dna is a food made from the pressed curds of milk.
"grated cheese"





2.
INFORMAL
the quality of being too obviously sentimental.
"the conversations tend too far toward cheese"
Feedback
Translations and more definitions a food made from the pressed curds of milk.
"grated cheese"





2.
INFORMAL
the quality of being too obviously sentimental.
"the conversations tend too far toward cheese"
Feedback
Translations and more definitions

I want a sister I can’t live like this with my parents

Answers

[tex] \large \sf{ah ! \: now \: what \: you \: will \: do?} \\ \large \sf{what \: did \: you \: decide?}[/tex]

Which of the following is NOT an example of a phenotype?
a. Wheat resistance to fungal infection
b. DNA sequence of the alcohol dehydrogenase gene
C. Color of a feather
d. Height of a giraffe

Answers

The answering would be A.

what is Chlorophytum borivilianum ?​

Answers

Answer:

Chlorophytum borivilianum is a herb with lanceolate leaves, from tropical wet forests in peninsular India. ... It is cultivated and eaten as a leaf vegetable in some parts of India, and its roots are used as a health tonic under the name safed musli. In traditional Indian medicine it is used as rasayan or adaptogen.

Plant name = Musli

Explanation:

Hope it's helpful to you dear❤ :-)

sorry

4
Correct
Drag each label to the correct location on the image.
Name the stages of the water cycle.
condensatio
17
precipitatiom
SIT
evaporation
runoff
Free
groundwat
Next

Answers

Answer:

condensation, precipitation, infiltration, runoff, and evapotranspiration.

condensation, precipitation, infiltration, runoff, and evapotranspiration are the correct steps of water cycle.

what is condensation ?

It is the process by which water vapor is converted into liquid water. It is an integral part of the water cycle.

It shows how water continually converts into three forms solid, liquid, gas throughout the earth surface.

The boiling point and the condensation point are same and take place at 100 degrees Celsius.

The temperature range of condensation occurs between 0 degree Celsius to  100  degree Celsius.

In water cycle due to condensation  water molecule  forms a cumulous clouds and fog followed by fall down of water droplets on the  Earth’s surface as precipitation, which is commonly called rain.

Rain water enters the earth’s waterways, soil absorbed by plants or   freeze into its solid form ice form.

Learn more about water cycle, here:

https://brainly.com/question/9243222

#SPJ5

Transcribe the following Strand of DNA:
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Answers

Answer:

CCGATAGGT

Explanation:

got this for my hw.

Answer:

So the central dogma of molecular biology describes the journey from DNA to protein product:

DNA --transcription--> mRNA --translation--> Protein

Assuming the DNA sequence provided is the template strand (rather than the complimentary coding strand), we start by transcribing the sequence into mRNA starting on the 3' end of the DNA towards the 5' end (which would build the mRNA 5' to 3'). This process involves the enzyme "RNA polymerase," which can only add nucleotides to the 3' end of the mRNA, just like how DNA polymerase can only synthesize DNA in the 5' to 3' direction. The RNA polymerase will bind to the template DNA strand and synthesize the complimentary mRNA, substituting uracil for thymine (since RNA does not contain thymine like DNA).

In terms of transcribing the sequence given to you, we'll have to work backwards + flip it around to get the 5' to 3' mRNA since the DNA is given 5' to 3' rather than 3' to 5'. Due to the length and the fact that we'll have to use triplets in translation anyways, it can help to break the sequence into triplet codons now.

5’-AAG | TTA | ATG | AGA | AAT | CGA | CAT | GGG | GCG | CCG | AAA | GTA | TAA | CCG | TCT | TAG | AAT | AGC-3’

We can then cross out each codon as we transcribe it and flip the sequence to be 5'-3' mRNA:

mRNA: 5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Normally, mRNA sequences start with "AUG" which is the start codon (and codes for Methionine), but I'll assume this is just for practice translating + transcribing in general. There's also a stop codon before the end but I'll assume the same again.

Translation involves three main steps - initiation, elongation, and termination. Initiation involves the translation ribosome assembling around the mRNA starting at the 5' end start codon, and tRNA carrying an amino acid binding to the complimentary section of the mRNA. As each tRNA attaches and the ribosome moves along the mRNA, the amino acids on each tRNA are bonded into a longer and longer peptide chain and the now amino acid-less tRNA are ejected (elongation). Termination occurs when a stop codon is reached, the ribosome will end elongation and help fold the protein into its final structure.

To translate the mRNA sequence here we'll need an amino acid/mRNA codon chart. I don't believe I can attach an image here, but looking up those exact words should yield the right results in images.

5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Ala - Ile - Leu - Arg - Arg - Leu - Tyr - Phe - Arg - Arg - Pro - Met - Ser - Ile - Ser - His - STOP - Leu

Amino acids are often abbreviated into three letters (Ala = alanine, Met = methionine, etc), and sometimes are abbreviated as single letters, though I've only seen that for sequencing databases.

In terms of locations for each of these processes, transcription occurs in the nucleus for eukaryotes and translation in the ribosomes/cytoplasm.

Explanation:

n

What is carrying capacity? What factors could influence the carrying capacity of a population?

Answers

Answer:

Carrying capacity can be defined as a species' average population size in a particular habitat. The species population size is limited by environmental factors like adequate food, shelter, water, and mates. If these needs are not met, the population will decrease until the resource rebound

Humans have increased the world's carrying capacity through migra:tion, agriculture, medical advances, and communication. The age structure of a population allows us to predict population growth. Unchecked human population growth could have dire long-term effects on our environment.tion

Plant and animal cells are both eukaryotic. This means they...
O Have a nucleus
O Contain DNA and RNA.
O Can reproduce on their own.

Answers

the answer is the first one they both have a nucleus!

Explain how cells theory development

Answers

Answer:

The invention of the microscope led to the discovery of the cell by Hooke. While looking at cork, Hooke observed box-shaped structures, which he called “cells” as they reminded him of the cells, or rooms, in monasteries. This discovery led to the development of the classical cell theory.20-Aug-2020

Explanation:

hope this. helpes

Please mark Brainliast

complete the crossword puzzle below.

down
1. a fat molecule is composed of _____ And 3 fatty acids.
2. means that hydrogen has been added to unsaturated fats
4 a large molecule whose main function is energy storage
6. unsaturated fats have move _____ bonds than saturated

UP
3. lipids are water-avoiding or _____
5. female and male hormones are example of ____
7. animal fats are said to be ____
pa help Po plss​

Answers

Answer:

1 down  hydroxyl

2 down Hydrogenation

4 down lipids

6 down

3 up

5 across androgen

7 up

Explanation:

that is all ik

3. Explain why unmanned marine vehicles are so useful provide specific examples
or facts from the video.

Answers

Unmanned marine vehicles are useful because they help with marine tasks, completing them in less time, reducing risks, reaching deeper areas.

Unmanned marine vehicles (UMV) are robotic vehicles controlled from afar that allow us to explore the sea and perform tasks with minimum risks.

UMV is useful because:

They substitute people working at the sea in risky tasks,They allow deeper exploration of the sea.They do tasks in less time than humans.

An example of how useful these marine vehicles are is during the construction of ports. They replace divers who have to do the job manually, spending many hours and risking their lives. With a UMV, there is no need for humans to go under the water, experts control the robot from the surface.

In conclusion, UMVs are useful because they are practical tools that save time and reduce risks.

Learn more about UMVs here:

https://brainly.com/question/6369359

Drag the tiles to the correct boxes to complete the pairs.
Match each organ to its function.
bone
heart
stomach
lung
pumps blood through the body
arrowRight
provides structure for the body
arrowRight
breaks down food into small particles
arrowRight
oxygenates blood
arrowRight

Answers

Bone —> provides structure for the body.

Heart —> pumps blood through the body.

Stomach —> breaks down food into small particles.

Lung —> oxygenates blood.

HELP QUICKLY Why are the deepest high tides so deep and the shallowest low tides so shallow? Hint: how are the Earth, Sun, and Moon aligned?

Answers

There are different kinds of tides. This change occur because  when the gravitational pull of the sun works along with the gravitational pull of the moon on Earth, it leads to the oceans bulging out.

This result above makes the high tides as been little higher and low tides been little lower than normal.

Spring tides are known to be the deepest as oceans levels are highest in this kind of tide. The neap tides are known to be the shallowest.

This often occurs when the moon, earth, and sun are said to be at a right-angled plane.  Therefore, the gravitation pull of the moon and sun on the oceans do counteract each other making its net effect is smaller.  

Learn more about Tide from

https://brainly.com/question/1133278

PLS HELP WHAT SHOULD I WIRTE?)
Write your own acrostic poem using the word "THANKFUL". You can use words or phrases for each line. Make sure to write about what you are thankful for.

Answers

Opening my eyes
And observing the skies
Feeling my mom's touch
And kissing her a bunch
As i watch her smile
Showing her mesmerizing teeth
Going out on saturdays
And watching friends on sundays
Is what i am thankful for everyday

А____is a quantity that has magnitude and direction

Answers

Answer:

Vector

Explanation:

Which forest biome has year-round
precipitation in many forms, is very
diverse with deciduous trees,
flowering trees, and shrubs, and
abundant growth in spring?
A. Temperate forest
B. Coniferous forest
C. Tropical rainforest
D. Tropical dry forest

Answers

Answer:

Due to their global position, temperate forests generally receive about 75-150 cm of precipitation every year.

Explanation:

(That's a lot, second only to the Tropics).

What kind of alleles get over-shadowed or blocked by more dominant alleles?

Answers

Recessive alleles are covered

Answer:

I believe these are called the recessive traits or alleles

Explanation:

Recessive traits (represented in a pinnet square usually by lower case letters like rr, bb, pp, mm, ll and so on and so forth)

These traits can be blocked by the dominant ones ( BB, Bb, PP and so on and so fourth)

look at the punnet square to get a better visual :3


True and False:
1. (______) Fungi and bacteria are both prokaryote organisms

2. (______) Some Fungi reproduce both sexually and asexually.

3. (______) Saccharomyces cerevisiae reproduce sexually by budding.

4. (______) Lactophenol cotton blue is mostly used for staining the dark mold

5. (______) Yeast is regarded as multicellular fungi and molds are unicellular fungi.

Answers

Answer:

1. Falso

2. Falso

3. Verdadero

4. Falso

5. verdadero

Explanation:

1. Las células de los animales, las plantas y los hongos son eucariotas

2. Los hongos se reproducen sobre todo por medio de esporas

3. cerevisiae se reproduce tanto asexual y sexualmente levaduras se reproducen asexualmente mediante un proceso conocido como gemación.

4. La tinción de Azul de lactofenol se emplea para observar hongos.

5. Los hongos pueden ser unicelulares o pluricelulares. Las levaduras son hongos unicelulares

what is the person's ultimate search in life? why?​

Answers

Answer: The ultimate purpose of life is to be at a higher positive frequency than negative, as you move through the vicissitudes of life, such that you feel content at the moment of death.

Contentment at the moment of death ensures that you reconnect to your positive soul self after death, review soul lessons, heal and recuperate.

If you are not content at the moment if death , you may get lost in an invisible maze of difficulties, as a spirit in a human form and gave a difficult after life & /or next life. .. To be content at the moment of death requires several years of training in detachment, meditation and positive thinking, through life.

Explanation:

The question 38 I can’t understand the question clearly

Answers

Answer:

The words are too blur for me darling

Explanation:

Maybe next time^^

P I E C K

___________

HELP ME!!!!

how did the psalmist express his awe and thanksgiving to god for his abiding presence and love for him?​

Answers

The Psalmist expresses his awe and thanksgiving to God for his affection by continually singing Him songs of praise.

The simplest way to thank God is to see Him everywhere and appreciate His presence in our life. It's important for us to remember that we are living because of Him.

The Psalms contain powerful quotes for giving thanks and finding blessings. Psalms 1 - 150 showed how the Psalmist was thanking God by singing praises to Him. The unifying theme of Psalms is praise for God.

Learn more about Psalms on:

https://brainly.com/question/2998438

scientific question about a monkey

Answers

Did we get our way of think through monkeys or spontaneously?
This ones weird but did man come from monkey?

I don’t understand help

Answers

Answer:

A

Explanation:

not 100% sure but it seems to be the only sensible answer

Whats atoms are found in human fat?

Answers

Fatty acids are constructed from the chemical elements carbon, oxygen and hydrogen. Fatty acids can be divided into a carboxylic acid head group–hence fatty acid–linked to a long chain of carbon atoms.

does that help?

How do protozoa and algae differ?

Answers

algae makes their own food while protozoa just digest things

Abagnale's life could best be paraphrased as...​

Answers

Answer:

running from the law and later working for  the law.

Explanation:

Frank Abagnale Jr. is the clear example of a boy who makes mistakes when trying to progress quickly without caring about his crimes, among which are the falsification of documents and checks, as well as the illegal practice of professions, which is why which during his youth had to flee from justice, however, due to the expertise he obtained after creating many false checks and his criminal journey, the American government gave him the possibility of working with them, contributing his knowledge of possible techniques fraud and help counter it, which was paradoxical considering his background.

Describe the structure and function of areolar connective tissue.

Answers

Answer:

Areolar Tissue is loose connective tissue that consists of a meshwork of collagen, elastic tissue, and reticular fibres - with many connective tissue cells in between the meshwork of fibres. The fibres that form the mesh structure of areolar tissue include: Collagen Fibres.

Other Questions
Author is to book as architect is to A) buildingB) landscapeC) plantingD) manfacturing Help help help help help write a note about wurtz reaction The _____ party system began when the Democratic-Republican Party split in the late 1820s.secondthirdfirstfourth SOLVE x + 3y = -1y = x - 7Write the solution below. I hate to ask for help but I know thats what you guys are here for. Ive been stuck on this sample work for over 2 weeks simply cause I dont understand it. Can any of you tell me the answers or help with it? 5. Why was the Berlin Wall built?Oto imprison Germany's Jews, Poles, Gypsies, and Slavsoto stop the East German government from adopting communismoto protect Berlin from invasion by the Soviet UnionOto prevent East Germans from escaping to West Germany Answer to question in picture Write the equation for 5x+ 2 y= 3 in slope-intercept form PLEASE HELP ME y= -5/2x+ 3xy=5/3x -3/5 y= -2/5x + 3/5 I need help on this question it says Find the quotient 605 What do the following two equations represent?9-3 = 2(x 3)y+5 2(+ 1)Choose 1 answer:The same lineonsDistinct parallel linesPerpendicular linesIntersecting, but not perpendicular linesHELP Assume ideal behavior. How many moles of are needed to fill a 2000L weather balloon at 210K and 1atm pressure? Round your answer to the nearest mole (use R = 0.082057 L atm mol-1K-1) please help! WILL MARK BRAINLIEST Yuan wrote 17 letters to friends each month for x months in a row. Write an expression to show how many total letters Yuan wrote. In the diagram below of triangle K L M KLM, N N is the midpoint of K M KM and O O is the midpoint of L M LM . If m M L K = 3 x + 75 MLK=3x+75, and m M O N = 93 3 x MON=933x, what is the measure of M L K MLK? A coffee shops blog allows people to post ideas about new coffee drinks, names of flavors, and future promotions. What two purposes does this blog have?to inform stakeholders about the companys performanceto gather feedback about products from customersto communicate job openings to prospective employeesto encourage customers to interact with one anotherto announce changes in the companys structure to investors Do now: Balance the following equation.1.CH + O--+--->- CO2 + H2O Help me answer this question please! Exert a force on the object, what happens to their state of motion Define Autonomy ???!???!???