Increased levels of CO2 make the ocean more acidic and put sea organisms in danger. This could mean slower growth in the world's corals reefs, which are already stressed and dying from the warmer ocean temperatures associated with increased greenhouse gases in the atmosphere.
What are the causes and effects of ocean acidification?Ocean acidification is mainly driven by carbon dioxide gas in the climate dissolving into the sea.
This directs to a lowering of the water's pH, making the sea more acidic. Many factors contribute to rising carbon dioxide levels.
Thus, correct option is "A" they product carbonic acid form the atmospheric carbon.
To learn more about ocean acidification click here:
https://brainly.com/question/15611772
#SPJ2
can anyone please tell why the bell jar is covered with black cloth in test for carbon dioxide ?
Answer:
To test
Explanation:
test
What are the properties of Oxygen Chalcogens and what is it used for?
explain conservation of matter in nature
Answer:
Conservation of matter in nature is that things cannot be magically created or destroyed.
Explanation:
What are two major surfaces on the moon? Which is younger?
Exam
What do we call information you've
gathered, whether through
experimentation or research?
A. hypothesis
B. data
C. conclusion
D. procedures
The characteristic of a cell membrane that allows materials to pass troughs it is called ?
A.synthesis
B.polarity
C.permeability
D.catalysis
Answer:
It's permeability
Explanation:
1. In the 1820s what did scientists think all dinosaurs really were
Answer:
yes dinosaurs were there
Explanation:
some fossils and skeleton models were found as proof
Q.which bird don't make its own nest?
The common cuckoo does not make a nest of its own, and they do not bring up their own young. Instead, the female lays her eggs in the nests of other birds. Each female cuckoo specialises in just one host species, and lays camouflaged eggs in that bird's nest.
When a plant drinks water the water has enters
Atmosphere
biosphere
geosphere
hydrosphere
Answer:
geosphere
Explanation:
What are examples of Geosphere?
It includes everything natural and lifeless that make up the surface of the earth. Examples are all the rocks and sand particles from dry land to those found at the bottom of the oceans. They also include the mountains, minerals, lava and molten magma from beneath the earth's crust.
Answer:
B. biosphere
Explanation:
The water that was in the hydrosphere has entered the roots of a plant and the plant is in the bioshere.
What is NOT a reason hydrogen bonds are significant?
Question 1 options:
Many molecules can have hydrogen bonding occur between them
They are extremely strong compared to ionic or covalent bonds
They are the reason for many of water's amazing properties
They are present in very common molecules found on Earth
Example of adhesion is when water sticks to _______ and cohesion is when water sticks to __________
Question 2 options:
Different molecules or surfaces, other WATER molecules
Solids, liquids
Liquids, Solids
Other WATER molecules, different molecules or surfaces
Hydrophilic substances, such as phosphate groups ___________
Question 3 options:
Fear and run away from water
Will not dissolve in water
Are attracted to hydrogen and other gases
Love to be surrounded by water
Which statement is NOT true?
Question 5 options:
Many sugars are not organic molecules
Sugar is used for a variety of purposes other than energy
Wood and paper are almost entirely sugar
Polysaccharides are carbohydrates
Answer:1. not as strong as ionic or covalent bonds. 2. Adhesion is when water sticks to other things, not water; cohesion is when similar molecules stick together. 3. Hydrophilic means liking water. 5. polysaccharides are carbohydrates
Explanation: self explanatory
function of typosole
Use a Punnett's squares to show a monohybrid cross between pure breeding parents of tall (T) and dwarf (t) pea plants.
The tall trait is dominant and thus is represented by the uppercase letter "T". The dwarf trait is recessive and is represented by
to lowercase letter "t".
Answer/Explanation:
True breeding means the parents have two copies of the same allele (two of the same letter)
That means the monohybrid cross is TT x tt
T T
t Tt Tt
t Tt Tt
All the offspring have one copy of each and are Tt. Tall is dominant to dwa rf. So all the offspring will be tall.
I WILL GIVE 100 POINTS!!
You have learned that heat moves from warm areas to cooler ones. In solids, heat is transferred by the physical touching of molecules. This type of heat transfer is called conduction. Some materials, like metal, conduct heat better than other materials. In fluids (liquids and gases), heat is transferred by convection currents caused by differences in density.
MATERIALS
hot water
cold water
metal fork
plastic fork
stick of cold butter
large glass
watch or clock with a second hand
yellow and blue food coloring
playing card
four empty, identical plastic bottles (sports drink bottles work well)
access to a sink
QUESTIONS
Part 1
What type of heat transfer is demonstrated in Part 1?
How long did it take for the butter to melt off of the plastic fork? The metal fork?
How do explain the difference in time between the two forks?
Part 2
What type of heat transfer is demonstrated in Part 2?
What happened when the warm water bottle was placed over the cold water bottle? Why?
What happened when the cold water bottle was placed over the warm water bottle? Why?
Pt. 1
In gases and liquids, heat is usually transferred by convection, in which the motion of the gas or liquid itself carries heat from one place to another. ... If you boil water in a kettle, the heat is transferred through convection from the fire to the pot.
Pt. 2
This motion of fluids is called convection. In the set of bottles where the hot water was above the cold water, the cold water was already on the bottom, so there was no convection.
Pt. 3
When the bottle was put into the cold water, the air in the bottle contracted, taking up a smaller space in the bottle. The sides of the bottle pushed in when the air inside controlled
Compare how both prokaryotes and eukaryotes use two of the cell
structures listed and describe the common functions of these structures
Answer:
I don't know I'm sorry
Explanation:
I don't remember but if you search it up it will give you the answer.
How does a enzyme work?
Using these words
“Speeding up the.... by lowering the...”
Like all catalysts, enzymes work by lowering the activation energy of chemical reactions.
A cell placed in a high salt solution would swell because of osmosis.
A. True
B. False
Answer:
false
Explanation:
False
explanation :
shrink
Hope this helps
please help! I really need help!
Polarity of bonds and molecules is determined by the of atoms involved.
Answer:
Bond polarity is determined by the difference in electronegativity and is defined as the relative ability of an atom to attract electrons when present in a compound.
Explanation: :))
electronegativity
Explanation:
usa test prep
which human activity negatively affects the stability of the enviroment
Answer:
pesticides
Explanation:
damages soil and plants
Which natural hazard is least likely to affect Florida?
A drought
B wildfire
C rip current
D tsunami
Answer:
c I think I'm taking the test atm
Explanation:
Answer:
d
Explanation:
quizlet
which of the following do not contribute to the decaying process
a. sunlight b. microorganism. c. sound. water
Given the sequence ATGGCGAATCACGTCACTTGA
a) Write the sequence of nucleotides for the complementary strand of DNA.
b) Write the mRNA sequence transcribed from the complementary strand.
c) What is the tRNA sequence that would be used to translate this sequence?
d) Convert the message into an amino acid sequence.
Answer:
a. TACG
b.UAC CGC UUA GUG CAG UGA ACU
c.ATCG
d.ser-arg-leu-val-ser-stop-thr
Explanation:
Which of the following is used to bind the bricks of the wall?
a) glass b) wool c) cement d) steel
if humans didn't exist what would the world be right now and the life on it
Answer:
"Effectively, there used to be large animals everywhere, and there would be large animals everywhere around the globe without human involvement." His research has revealed that without humanity's heavy species impact, the central United States, and parts of South America,
Explanation:
NPR. Imagining a World Without Humans What would happen to the Earth if all humans suddenly disappeared? In his new book, The World Without Us, author Alan Weisman discusses how long it would take for all evidence of human life to vanish from the planet.
10 Species That Would Dominate if Humans Died Out
The Rats. Rats love disasters. ...
The Bears. Humans are unquestionably masters of the planet. ...
The Dogs. If you've ever been to a developing nation, you know that dogs are already in charge of large swathes of the planet. ...
The Ants. ...
The Pigs. ...
The Octopi. ...
The Racoons. ...
The Cockroaches.
temperature of water in morning
what force dose dark energy have on the universe?
What are the approximate coordinates of the star Rigel?
Answer:
approximately 860 light-years (260 pc) from Earth
Juanita and Alfred hypothesize that a seed will sprout faster if it is warmer. They plant three seeds and water them the same amount. One seed is placed near a heater, one is left at room temperature, and one in a refrigerator. The results are shown in the table below. Do the results support the hypothesis?
Temperature of Seed Days to Sprout
by heater 2 days
room temperature 5 days
in refrigerator did not sprout
A.
No, because the seeds all sprouted at the same time.
B.
Yes, because the cooler seeds sprouted sooner.
C.
Yes, because the warmer seeds sprouted sooner.
D.
No, because the cooler seeds sprouted sooner.
Answer:
C
Explanation:
Yes, because the warmer seeds sprouted sooner.
Yes, because the warmer seeds sprouted sooner.
What is Room temperature?
The typical temperature range in a home is widely agreed to be between 68 and 76 degrees Fahrenheit, specific variations and geographic variations aside.
The use of smart home appliances, such as a smart AC controller, automates the maintenance of these typical house temperatures at all times, however keeping the ideal room temperature is a challenge.
The location, season, type of house, and personal preferences are just a few of the many variables that can dramatically affect the appropriate room temperature. When determining appropriate room temperatures, home architecture is a crucial factor.
Therefore, Yes, because the warmer seeds sprouted sooner.
To learn more about Warmer seeds, refer to the link:
https://brainly.com/question/7589654
#SPJ2
Describe the levels of organization of a human being
Answer:
wassup ExTrA
Explanation:
Life processes of the human body are maintained at several levels of structural organization. These include the chemical, cellular, tissue, organ, organ system, and the organism level. Higher levels of organization are built from lower levels.
hope this helps
when a piece of zucchini is soaked in salt water, the zucchini loses its firmness. Which process best explains what happens to the zucchini?
Explanation:
The zucchini is breaking down which we already know bit the zuchinni is absorbing and breaking down at the same time so when that happens the cells are expanding and breaking
think of a water balloon
Answer:
The cells in the zucchini shrink because they lose their water.
Explanation: