HELP PLEASE !!!
Fahrenheit and centigrade temperatures are related by the formula C = 5(F - 32) / 9 , where and F represent the temperatures in °C and ° F respectively . If the directions for a chemical experiment require that the temperature of a certain liquid be kept between 25 ° C and 30° C , what range of temperatures in ° F will satisfy the temperature restrictions of the liquid ?
Answer:
like this question
Explanation:
I will be giving example only
What are the approximate coordinates of the star Rigel?
Answer:
approximately 860 light-years (260 pc) from Earth
Glucose is an organic compound produced during the process of photosynthesis. Select the word below that best describes glucose.
B. Nucleotide
A. Polypeptide
C. Monosaccharide
D. Steroid
Answer:
C. Monosaccharide
Explanation:
Glucose is an carbohydrate molecule with the chemical formula, C6H12O6. It is one of the simplest form of carbohydrates called MONOSACCHARIDE OR SIMPLE SUGAR. This means that it has a single ring in its chemical structure. Other monosaccharides are fructose, galactose etc.
As stated in this question, Glucose is produced as energy source during the process of photosynthesis in plants i.e. the combination of carbon dioxide (CO2) and water (H2O).
Which natural hazard is least likely to affect Florida?
A drought
B wildfire
C rip current
D tsunami
Answer:
c I think I'm taking the test atm
Explanation:
Answer:
d
Explanation:
quizlet
What are the importance of family resources?
What are two major surfaces on the moon? Which is younger?
Karissa is conducting an experiment on the amount of salt that dissolves in water at different temperatures. She repeats her tests several times using the same procedure.
What can Karissa do to further increase confidence in the results of her experiment?
1.have another scientist run the same exact procedure in her lab
2.include several other liquids for comparison
3.calculate the average amount of salt that dissolves to summarize findings
4.make sure the experiment follows a specific procedure that allows other scientists to produce the same findings
Valid Expressions are; t = ∛(d²/va), a = d/t², a = √(vd/t³), v = at
while the Invalid expressions are; v = a/t and d = at
Explanation:
Given expressions
1) v = a/t
2) t = ∛(d²/va)
3) d = at
4) a = d/t²
5) a = √(vd/t³)
6) v = at
First we get our units of parameters
V = m/s, t = sec, d = m, a = m/s²
so
1)
v = a/t
we substitute in our units of parameters
v = m/s² / s = m/s² × 1/s = m/s³
v ≠ m/s³
therefore it is false
2)
t = ∛(d²/va)
we substitute
t = ∛(m² / m/s × m/s²)
t = ∛(m² / m²/s³)
t = ∛(s³)
t = s
correct, the expression is true
3)
d = at
we substitute
d = m/s² × s
d = m/s² × s/1 = ms/s² = m/s
d ≠ m/s (because d = m)
so expression is false
4)
a = d/t²
we substitute
a = m / s² = m/s²
correct
the expression is true
5)
a = √(vd/t³)
we substitute
a = √(m/s×m / s³) = √(m²/s / s³) = √(m²/s × 1/s³) = √(m²/s⁴) = m/s²
so a = m/s²
correct
the expression is true
6)
v = at
we substitute in the units
v = m/s² × s = m/s² ×s/1 = ms/s² = m/s
v = m/s
correct
the expression is correctValid Expressions are; t = ∛(d²/va), a = d/t², a = √(vd/t³), v = at
while the Invalid expressions are; v = a/t and d = at
Explanation:
Given expressions
1) v = a/t
2) t = ∛(d²/va)
3) d = at
4) a = d/t²
5) a = √(vd/t³)
6) v = at
First we get our units of parameters
V = m/s, t = sec, d = m, a = m/s²
so
1)
v = a/t
we substitute in our units of parameters
v = m/s² / s = m/s² × 1/s = m/s³
v ≠ m/s³
therefore it is false
2)
t = ∛(d²/va)
we substitute
t = ∛(m² / m/s × m/s²)
t = ∛(m² / m²/s³)
t = ∛(s³)
t = s
correct, the expression is true
3)
d = at
we substitute
d = m/s² × s
d = m/s² × s/1 = ms/s² = m/s
d ≠ m/s (because d = m)
so expression is false
4)
a = d/t²
we substitute
a = m / s² = m/s²
correct
the expression is true
5)
a = √(vd/t³)
we substitute
a = √(m/s×m / s³) = √(m²/s / s³) = √(m²/s × 1/s³) = √(m²/s⁴) = m/s²
so a = m/s²
correct
the expression is true
6)
v = at
we substitute in the units
v = m/s² × s = m/s² ×s/1 = ms/s² = m/s
v = m/s
correct
the expression is correct
What are the properties of Oxygen Chalcogens and what is it used for?
People began to live together in locations that favored trade.
By 3000 b.C., several villages had developed into cities in
Sumer, a region in southern Mesopotamia
True
False
temperature of water in morning
How does a enzyme work?
Using these words
“Speeding up the.... by lowering the...”
Like all catalysts, enzymes work by lowering the activation energy of chemical reactions.
A cell placed in a high salt solution would swell because of osmosis.
A. True
B. False
Answer:
false
Explanation:
False
explanation :
shrink
Hope this helps
Use a Punnett's squares to show a monohybrid cross between pure breeding parents of tall (T) and dwarf (t) pea plants.
The tall trait is dominant and thus is represented by the uppercase letter "T". The dwarf trait is recessive and is represented by
to lowercase letter "t".
Answer/Explanation:
True breeding means the parents have two copies of the same allele (two of the same letter)
That means the monohybrid cross is TT x tt
T T
t Tt Tt
t Tt Tt
All the offspring have one copy of each and are Tt. Tall is dominant to dwa rf. So all the offspring will be tall.
Which cells can form ATP by breaking down glucose?
a
Animals only
b
Prokaryotes only
c
All cells
d
Plants only
Answer:
C. All cells
Explanation:
Just took the assignment
This is confusing for me so, first answer gets brainly Est PLEASEEEE
"Can dogs identify colors?" is an example of a scientific question. "Are dogs better pets than cats?" is not. Use complete sentences to explain the difference between these questions and why only one is scientific.
Answer:
"Can dogs identify colors?" is scientific while "Are dogs better pets than cats?" is not.
Explanation:
"Can dogs identify colors?" is scientific because it is a hypothesis that can be tested, it avoids opinion, it is specific, and the experiments involved in proving it can be repeatable. These are all characteristics of a good scientific question. "Are dogs better pets than cats?" is not scientific because it is opinionated, and it does not involve any experiments that would fail or prove it.
g Identify the statements that accurately describe how hydrogen ion concentration relates to energy production in oxidative phosphorylation. Hydrogen ion concentration is lower in the mitochondrial matrix than in the intermembrane space. The pH in the mitochondrial matrix is lower than the pH in the intermembrane space. Energy is generated as a result of the difference in hydrogen ion concentration between the intermembrane space and the cytoplasm. Oxidative phosphorylation relies on the hydrogen ion concentration gradient generated and maintained by the electron transport chain. Hydrogen ions enter the mitochondrial matrix via facilitated diffusion.
Answer:
- Hydrogen ion concentration is lower in the mitochondrial matrix than in the intermembrane space.
- Oxidative phosphorylation relies on the hydrogen ion concentration gradient generated and maintained by the electron transport chain.
- Hydrogen ions enter the mitochondrial matrix via facilitated diffusion.
Explanation:
Oxidative phosphorylation is a metabolic pathway by which Adenosine Triphosphate (ATP) molecules are produced through the transfer of electrons from NADH or FADH2 to molecular oxygen (O2). The hydrogen (H+) ions are pumped from the mitochondrial matrix to the intermembrane space, and this movement of protons generates an electrochemical gradient across the mitochondrial membrane which is used by the ATP synthase to produce ATP. This gradient is generated by the movement of electrons through a series of electron carriers (e.g., cytochrome c and ubiquinone) that are embedded in the inner mitochondrial membrane. The movement of these H+ ions across the semipermeable mitochondrial membrane moving down their electrochemical gradient is named chemiosmosis and is an example of facilitated diffusion.
Potatoes are native to Monuntainous areas of Bolivia and Peru in South America, but are now grown widely around the world. What kinds or environmental conditions do you think areas must have in common for a crop to be successful around the world?
Answer:
Potatoes grew in the mountainous regiosn of Bolivia and Peru because they prefers such climates. Climates that are on the cold side but not so cold that the ground would be frosty. A temperature of between 60° to 70°F is considered ideal and anything above 80° F is considered too warm for them even though they have been known to adapt.
The soil should be very mildly acidic with a pH of between 5.0 to 5.5. Potatoes prefer to be grown in the full presence of the sun in well drained soils that are not compact or constantly wet.
The Environmental conditions are therefore;
Cold but not too coldWell drained soilMildly acidic soil.Abundance of sunlight.Could someone help me plz!
Answer:
I think that D is the correct answer
When a plant drinks water the water has enters
Atmosphere
biosphere
geosphere
hydrosphere
Answer:
geosphere
Explanation:
What are examples of Geosphere?
It includes everything natural and lifeless that make up the surface of the earth. Examples are all the rocks and sand particles from dry land to those found at the bottom of the oceans. They also include the mountains, minerals, lava and molten magma from beneath the earth's crust.
Answer:
B. biosphere
Explanation:
The water that was in the hydrosphere has entered the roots of a plant and the plant is in the bioshere.
if the values for both mass and volume double, the value of the density will be?
Answer:
Stays the same.
Explanation:
Density = mass/volume
So if :
M/V = D
And if we were to double mass(M) and volume (V)
2M/2V = D
It will stay the same because the 2 and 2 would cancel out and we'd get the same density as the original value.
I WILL GIVE 100 POINTS!!
You have learned that heat moves from warm areas to cooler ones. In solids, heat is transferred by the physical touching of molecules. This type of heat transfer is called conduction. Some materials, like metal, conduct heat better than other materials. In fluids (liquids and gases), heat is transferred by convection currents caused by differences in density.
MATERIALS
hot water
cold water
metal fork
plastic fork
stick of cold butter
large glass
watch or clock with a second hand
yellow and blue food coloring
playing card
four empty, identical plastic bottles (sports drink bottles work well)
access to a sink
QUESTIONS
Part 1
What type of heat transfer is demonstrated in Part 1?
How long did it take for the butter to melt off of the plastic fork? The metal fork?
How do explain the difference in time between the two forks?
Part 2
What type of heat transfer is demonstrated in Part 2?
What happened when the warm water bottle was placed over the cold water bottle? Why?
What happened when the cold water bottle was placed over the warm water bottle? Why?
Pt. 1
In gases and liquids, heat is usually transferred by convection, in which the motion of the gas or liquid itself carries heat from one place to another. ... If you boil water in a kettle, the heat is transferred through convection from the fire to the pot.
Pt. 2
This motion of fluids is called convection. In the set of bottles where the hot water was above the cold water, the cold water was already on the bottom, so there was no convection.
Pt. 3
When the bottle was put into the cold water, the air in the bottle contracted, taking up a smaller space in the bottle. The sides of the bottle pushed in when the air inside controlled
Men who are “benevolent sexist” have positive feelings about women as a group but,
Answer:
w
Explanation:
w
Answer:
Men who are "benevolent sexists have positive feelings about women as a group but men based on shows that women have difficulty identifying benevolent sexist acts as sexist or negative emotional associations between particular attributes and groups.
Explanation:men
can anyone please tell why the bell jar is covered with black cloth in test for carbon dioxide ?
Answer:
To test
Explanation:
test
explain conservation of matter in nature
Answer:
Conservation of matter in nature is that things cannot be magically created or destroyed.
Explanation:
which human activity negatively affects the stability of the enviroment
Answer:
pesticides
Explanation:
damages soil and plants
During the process of replication, a molecule of DNA unzips, forming two single strands what makes up each individual strand of DNA?
A( paired adenine and uracil bases
B( Paired thymine and guanine bases
C( sugar groups attached to individual amino acids
D( nitrogenous bases attached to a sugar- phosphate backbone
DNA is a nucleic acid that gets duplicated by replication. The single strand of DNA is made of nitrogenous bases attached to a sugar-phosphate backbone. Thus, option D is correct.
What is DNA?DNA is the abbreviated form of deoxyribose nucleic acid that is the major molecule involved in inheritance and genetics. DNA undergoes a replication process where the two daughter strands, semiconservative in nature are produced.
The DNA is a polymer composed of the sugar (deoxyribose) - phosphate backbone along with nitrogen bases that include adenine, thymine, cytosine, and guanine. The phosphodiester bond, hydrogen bond, and glycosidic bonds are involved in interlinking the structural framework.
Therefore, option D. the sugar-phosphate backbone linked to the nitrogenous bases makes the structure of DNA molecule.
Learn more about DNA here:
https://brainly.com/question/13522078
#SPJ2
which of the following do not contribute to the decaying process
a. sunlight b. microorganism. c. sound. water
Given the sequence ATGGCGAATCACGTCACTTGA
a) Write the sequence of nucleotides for the complementary strand of DNA.
b) Write the mRNA sequence transcribed from the complementary strand.
c) What is the tRNA sequence that would be used to translate this sequence?
d) Convert the message into an amino acid sequence.
Answer:
a. TACG
b.UAC CGC UUA GUG CAG UGA ACU
c.ATCG
d.ser-arg-leu-val-ser-stop-thr
Explanation:
Which are examples of harmful mutations? Check all that apply. one that causes a person to have a light patch of hair color one that changes a mouse’s eye shape but not its eyesight one that allows a moth to blend into its environment one that reduces a bean plant’s ability to make food one that increases the plants susceptibility to diseas
Answer:
2, 4, 5
Explanation:
Juanita and Alfred hypothesize that a seed will sprout faster if it is warmer. They plant three seeds and water them the same amount. One seed is placed near a heater, one is left at room temperature, and one in a refrigerator. The results are shown in the table below. Do the results support the hypothesis?
Temperature of Seed Days to Sprout
by heater 2 days
room temperature 5 days
in refrigerator did not sprout
A.
No, because the seeds all sprouted at the same time.
B.
Yes, because the cooler seeds sprouted sooner.
C.
Yes, because the warmer seeds sprouted sooner.
D.
No, because the cooler seeds sprouted sooner.
Answer:
C
Explanation:
Yes, because the warmer seeds sprouted sooner.
Yes, because the warmer seeds sprouted sooner.
What is Room temperature?
The typical temperature range in a home is widely agreed to be between 68 and 76 degrees Fahrenheit, specific variations and geographic variations aside.
The use of smart home appliances, such as a smart AC controller, automates the maintenance of these typical house temperatures at all times, however keeping the ideal room temperature is a challenge.
The location, season, type of house, and personal preferences are just a few of the many variables that can dramatically affect the appropriate room temperature. When determining appropriate room temperatures, home architecture is a crucial factor.
Therefore, Yes, because the warmer seeds sprouted sooner.
To learn more about Warmer seeds, refer to the link:
https://brainly.com/question/7589654
#SPJ2