can someone please help me find important dates from the 15th and 16th century of European exploration.

Answers

Answer 1

Answer: In the 1500s to 1600s Portugal, Spain, England, and France establish the slave trade from Africa to bring workers to sugar and tobacco plantations in South America and the Caribbean, and later to the cotton plantations in the southern U.S. religious Reformation begins. Protestant religions emerge in Europe.


Related Questions

Who envented electricty?

Answers

Well nobody technically did invented it but learned how to use it. But the people who discovered it was Alexander Lodygin and William Greener should be the answer
Thomas Jefferson lol

What is the role of family in the philosophy?

Answers

Explanation:

as basic and essential building blocks of societies, families have a crucial role in social development. they bears the primary responsibility for the education and socialization of children as well as instilling values of citizenship and belonging in the society.

How did the US claim Florida? Who owned Florida in the first place? Why did they give up the land to the US?

Answers

Answer:

The U.S. purchased Florida with the signing of  Florida Purchase Treaty. Spain and Britain owned Florida at first. Spain did not need Florida, and it was burden to them. So they got rid of it with the U.S.

Explanation:

I hope this helps.

Answer:

Ikd Florida is the male genitalia for the U.S.

Explanation:

YW

who invented the word good morning

Answers

Cheery John Smiley
The man who invented the phrase 'Good Morning' has been found fatally murdered in his apartment. Cheery John Smiley coined the phrase back in 1952 as a way of making his employees feel valued as they arrived for work. Rest In Peace

Cheery John Smiley invented the word good morning.

What is invention?

An invention is a unique or novel device, method, composition, idea or process. An invention may be an improvement upon a machine, product, or process for increasing efficiency or lowering cost. It may also be an entirely new concept.

Cheery John Smiley coined the phrase back in 1952 as a way of making his employees feel valued as they arrived for work. Cheery in 1952, John Smiley created the term “Good Morning” to make his staff feel valued when they came for work. Nonetheless, with the exception of some who believe it is impolite in the United States, the term has been passed down to nearly everyone around the world.

Therefore, Cheery John Smiley invented the word good morning.

To learn more about invention, click here:

https://brainly.com/question/6457321

#SPJ2

PLEASE HELP ASAP DUE IN 2 HOURSSS!!!!

Answers

1 Anne Frank’s diary had became famous throughout the world the diary provided a vivid and poignant in glimpse into the world of a young Jewish girl living in Nazi occupied Holland and roll diary well hiding from the Nazis in the Amsterdam warehouse
2 and Frank was 11 years old in 1941 the armies of Adolph Hitler invaded Holland where is she lived with her parents and her older sister Hitler was the Nazis ruler of Germany they were frightened and a palled when Hitler took over Holland in terrorist in families went into hiding
yeahh what the other person said was right!

Citizens may propose new laws using a process called a(n)
recall.
referendum.
initiative.
opinion poll.

Answers

answer: (not sure)

initiative

explanation:

the initiative process is the direct power of the voters to enact new or change existing laws it allows the voters to place proposed legislation on the ballot the only limitation in scope is that an initiative cannot be used to amend the State Constitution

Answer:

It is c, Initiative

Explanation:

I got it correct

Even though Herbert Hoover had less political experience than Alfred E. Smith, Hoover won the ________________ of 1928.
A. contest
B. competition
C. election
D. vote

Answers

The answer is C!! Hope this helps :)

Answer:

C

Explanation:

How did Europe’s merchants change the world trade system?

Answers

They traded which helped economy

Write an argument that explains to a reluctant patient the advantages that synthetic medicines may have over natural remedies.

Answers

Answer:

what are you talking about

Explanation:

Answer:

Herbal therapy is a holistic therapy, integrating emotional, mental and spiritual levels. Life style, emotional, mental and spiritual considerations are part of any naturopathic approach. The use of herbs does not generally involve "drug" actions or adverse effects. Although medicinal plants are widely used and assumed to be safe, however, they can potentially be toxic. Where poisoning from medicinal plants has been reported, it usually has been due to misidentification of the plants in the form, in which they are sold, or incorrectly preparation and administration by inadequately trained personnel.

Explanation:

help Me please people .........uwu

Answers

Answer:

1-A 2-A 3-D 4-A

Explanation:

Hope this helps!

What were Justinian's achievements?



Choose all correct answers.


He created a code of law that helped unite the Byzantine Empire and later served as a model for the codes of law in many modern nations.

He doubled the size of the empire and ruled much of the Mediterranean world.

He built a huge domed cathedral called the Hagia Sophia, an enormous underground aqueduct, and a fabulous palace complex.

He moved the imperial capital from Rome to Byzantium, so it would attract people from all over the world.

Answers

Answer:

He doubled the size of the empire and ruled much of the Mediterranean world.

He created a code of law that helped unite the Byzantine Empire and later served as a model for the codes of law in many modern nations.

He built a huge domed cathedral called the Hagia Sophia, an enormous underground aqueduct, and a fabulous palace complex.

Explanation:

A B and d i think is the newer

From “Harriet Tubman on the Underground Railroad by Ann Petry

“This time she told them about the long agony of
the Middle Passage on the old slave ships, about
the black horror of the holds, about the chains
and whips. They too knew these stories." What is
the impact of the word choices the author uses
to convey her viewpoint in the phrases "long
agony" and "black horror"?


А) She wants them to feel what
the ancestors felt.

B) They suggest the terrible
misery experienced by the
people's ancestors.

C) To convey that Harriet Tubman
wanted them to know their
history

D) They are used to add drama to
the text.

Answers

I thinks it’s B. It might be C but I think it’s B
answer choice b is correct

The phrases "long agony" and "black horror" describe the Middle Passage. The impact of the word choices in this paragraph suggest the terrible misery experienced by the people's ancestors. The first sentence develop the text's key idea that the escape from slavery was terrifying and the comparison to the Middle Passage brings the idea full circle; their people's slavery began in terror and agony, and their escape from it will be difficult as well.

hope this helps :)

What former president of Mexico declared himself president again and unsuccessfully tried to fight off the U.S.?

Answers

Answer:

Santa Anna

Explanation:

Byzantium was an ancient Greek city-state founded around 600 BC. The people settled there because of a thin strip of water that connected _______ to _______ and the Black Sea to the _____________. This strip of water is called the __________. Today the word byzantine means old or devious, but during its eleven-hundred-year history, the Byzantine Empire saved the western world’s heritage of literature and put ___________ on the fast track. This happened under a single Roman Emperor named Constantine.

Answers

Asia, Europe, Mediterranean, Bosporus, Christianity are the correct answer.

How did Huey Long’s policies distinguish Louisiana from other southern states?

He attracted northern industrialists to the state by emphasizing industrial production over agriculture.

He allowed the rich to control more of the state’s wealth by eliminating state income taxes.

He reduced tensions in the state by including African Americans in his benefits programs.

He enforced white supremacy by making the Klu Klux Klan an official state organization.

Answers

Answer:

Senator Huey P. Long, Statement of the Share Our Wealth ... according to the estimates of the statisticians of the United States Government and Wall Street, ... to be equal in opportunity in all schools, colleges, universities, and other ... ☐D. a leader who enacts policies to improve the lives of the common people.

WILL GIVE BRAINLIEST AND EXTRA POINTS IF YOU COMPLETE THIS
(WORLD HISTORY)

As we've discussed, history is full of causes and effects. In the space below, write an overview or summary of the Crusades.

In 7-10 sentences (or more) summarize the causes and effects of The Crusades.

Please be sure to include the following:

- Economic, Social, and Political causes of the Crusades.

- Describe how certain Crusades led to another and its impact on Europe.

Answers

Answer:

The Crusades were military expeditions organized by western European Christians to keep in check the spread of Islam and recapture former Christian territories that now were Muslim. The Crusades began in 1095 and lasted for almost 200 years.

To some historians, even when these religious wars presented gruesome results, they ultimately were a factor in European civilization development as the growth of the system of indulgences and the reinforced link between Western Christendom, feudalism, and militarism, led to the Protestant Reformation.

Explanation:

What justification (reason) does Jackson give for Indian Removal? (need 2)

Answers

Answer:

The American Indian Removal policy of President Andrew Jackson was prompted by the desire of White settlers in the South to expand into lands belonging to five Indigenous tribes. After Jackson succeeded in pushing the Indian Removal Act through Congress in 1830, the U.S. government spent nearly 30 years forcing Indigenous peoples to move westward, beyond the Mississippi River.

In the most notorious example of this policy, more than 15,000 members of the Cherokee tribe were forced to walk from their homes in the Southern states to a designated territory in present-day Oklahoma in 1838. Many died along the way.

This forced relocation became known as the “Trail of Tears” because of the great hardship faced by Cherokees. In brutal conditions, nearly 4,000 Cherokees died on the Trail of Tears.

Which statements accurately describe trade in the Ghana Empire?



Choose all correct answers.


Gold could be traded for salt, which was used to preserve food and maintain health.

Copper and tin were the two metals that led to the prosperity of the kingdom of Ghana.

Cotton and silver were the two main items traded in Ghana.

Iron goods made by Ghanaian blacksmiths were highly prized trade items.

Answers

Answer:

Gold could be traded for salt,which was used to preserve food and maintain health

Answer:

1.Gold could be traded for salt,which was used to preserve food and maintain health

2. Iron goods made by Ghanaian blacksmiths were highly prized trade items.

Explanation:

In the Supreme Court case of McCulloch vs. Maryland, Chief Justice John Marshall established the three principles of judicial review.

A: True


B: False

Answers

Answer:

False

Explanation:

It was established in 1803 Marbury v. Madison. "It is emphatically the province and duty of the Judicial Department to say what the law is…If two laws conflict with each other, the Courts must decide on the operation of each."

False sorry if it’s wrong just trying to answer one

What happened during the 1975 Australian constitutional crisis

Answers

Answer:

The capture of Saigon by the North Vietnamese Army in April 1975 marked the end of the war, and North and South Vietnam were reunified the following year.

Explanation:

i want brainiest

3 reasons gun control is not the solution to our countrys voilence issue, or three reasons why it is?

Answers

Answer:

1. people don't change

2. Some one hunts and gun control will stop them from showing there hobby

3. Home break ins people need defense

Explanation:

Answer:

The not-

Explanation:

Over 90 percent of public mass shootings take place in “gun-free zones” where civilians are not permitted to carry firearms.

Mass killings are very rare, accounting for only 0.2 percent of homicides every year and approximately 1 percent of homicide victims

A prominent 2017 study defined “mass public shootings” as incidents that occur in the absence of other criminal activity (such as robberies, drug deals, and gang-related turf wars) in which a gun is used to kill four or more victims at a public location.

can you please write 4 interesting facts about gefferey holder
PLEASE HELP and actually answer if ou answer

Answers

Answer:

Geoffrey Lamont Holder was a Trinidadian-American actor, dancer, musician, and artist. He was a principal dancer for the Metropolitan Opera Ballet before his film career began in 1957 with an appearance in Carib Gold. In 1973, he played the villainous Baron Samedi in the Bond film Live and Let Die.

Explanation:

Geoffrey Lamont Holder was a Trinidadian-American actor, dancer, musician, and artist. He was a principal dancer for the Metropolitan Opera Ballet before his film career began in 1957 with an appearance in Carib Gold. In 1973, he played the villainous Baron Samedi in the Bond film Live and Let Die. Wikipedia

What would you have done if you were the monarch of France at the time to remedy considering long term & Short term causes of French Revolution?


please don't give me 'some random answer that isn't even related to the question' for the points

thank you :D

Answers

Answer: Unlike Louis XVI, I wouldn't undermine the people's power and ruin their perception of myself. Furthermore, I wouldn't be as eager to aid America in the War of Independece, since the ideas of freedom and independence influenced the soldiers returning home from that war. A victory from this war would encourage the French people that they could also earn their independence from the monarch. As a monarch, I wouldn't encourage this war but try to diminish it's significance in front of the French people.

Explanation:

Please help Im on a time crunch :((

Answers

Wdym i need more information of what your saying

According to the humanist Desiderius Erasmus, what should people do to become better Christians?

A. Education
B. Prayer
C. Pride
D. Reason

Answers

Prayers and Repent from our sins

Why did the united states enter the WW2?
A)to stop germany from invading poland
B)to stop hilter from becoming chancellor of germany
C)to prevent italy from converting to facism
D)to protect their allies Britain and france

Answers

Answer:

D

Explanation:

Who was one of the few well known female writers of the Renaissance who wrote about equal rights and education for women?

Wollstonecraft

Alighieri

Cervantes

de Pisan

Answers

Christine de Pisan was a French Renaissance writer who wrote some of the first feminist pieces of literature.

Plsss Help!!! Will mark brainiest!!
How did the Roman confederation discourage revolt among the Roman people?
A. Promoted for treatment of conquered people.
B. It lowered taxes for all Roman citizens and allies.
C. It permitted Roman allies to serve in the government.
D. It’s strengthened military presence in strategic locations.

Answers

I’m pretty sure the answer is A
A. Promoted for treatment of conquered people

Plssss Help!!! Will mark brainiest!
Study the table and answer the question.
The list outlines the rights and duties of which group?
A. Tribunes
B. Praetors
C. Consuls
D. Patricians

Answers

Answer:

B. Praetors

Explanation:

Tell me if I'm wrong

The answer to this question is B

When we ask, “What was Alexander’s legacy?,” what are we asking?

Answers

Answer:

You are asking what his major accomplishments were / what he was known for !

Explanation:

Other Questions
????help me please #6thgrademath Over which interval does f(t) have positive average rate of change Please help me ASAP please do not put a link Hello. Any one has an idea for a photo that represent the situation we are living. I mean C-O-V-I-D style. Its for class. I will give brainliest A force of 20,000 N is exerted for 5.00 s, on a 75,000 kg mass. What is the impulse of the force for this 5.00 s ? Add a comma or semicolon if needed. Otherwise, submit the text without any additionalpunctuation.Keenan focuses his workouts on building strength and lean muscle mass _ to do so, heperforms a variety of exercises using the barbells and weight machines at the gym. the best answer it requests services, data and other resources available on the server What are the sins committed by Don Pedro and Don Diego against Don Juan? Radioactive decay occurs when the ____ decays Read the following sentence:Some kinds of water quality can be checked right in the stream or at the well.Which answer correctly uses domain-specific language to strengthen the writing? A)Some aspects of water quality can be determined directly in the stream or at the well.B)Some kinds of water quality can be figured out right in the stream or at the well.C)Some types of water quality can be tested right in the stream or at the well.D)Some aspects of water quality can be checked right in the stream or at the well. Please complete the following DNA strands1. AGGTCCAAGCTCAAATTTCCCC2. GAAACCCCTTAAACCTTAATTCC3. GCGCGCGCAAATTTTTCCCATCTPlease complete the following strands using RNA:1. AGGTCCCAAAGGCCCTTTCC2. UAAAGGGCCCAGCCCACC3. CUAAAAGGGGGUUUUAACC What is 1/12 cups converted into ounces? Match the countries and their aims after World War I.GermanyFranceItalyUnited Stateswanted to establish a lasting peace in Europewanted a treaty based on the armistice it had signedwanted territories near the Adriatic that Britain had earlier promisedwanted to punish and weaken Germany Plz, answer this question plz! Plz, answer this question plz! Plz, answer this question plz! Plz, answer this question plz! Plz, answer this question plz! I need help with these two questions Bob ate 1/3 loaf of bread over 4 days. He ate the same amount of bread each day. What fraction of the loaf did Bob eat each day? danielle did not complete 15 of her 200 assignments last year. Kim said that is 0.075 of her assignments and Kelly said it is 0.75 of her assignments. Who is correct and how do you know? A ___________ is a large volcano built up of alternating layers of lava and ash, or cinders.a.stratovolcanoc.cinder coneb.shieldd.stratus volcanoPlease select the best answer from the choices providedBRAINLYIST PROVIDED I NEED HELP GUYSDid the French Revolution achieve its goals? Why ? Or why not? the cost of lunch l after a 15% tip can be represented by the expression l + 0.15l. Simplify the expression. Then determine the total cost of the lunch after the lunch bill is $10.