Answer:
in the 46 chromosomes in our body, the autosomes are the first 22 homologous pairs of chromosomes that do not influence the sex of an individual, while sex chromosomes are the 23rd pair of chromosomes that determine the sex of an individual
hope this helps, good luck! : )
A. Red tailed hawks
B. White spruces
C. Red foxes
D. Lynx
Answer:
Red foxes
Explanation:
The arrow shows the transfer of energy from the shrew to the red fox
ASAP due today
Explain one challenge we face using nuclear energy.
Answer:
The major challenges facing the nuclear industry include ensuring power plant safety, protecting reactors from natural disasters and external aggression, and finding effective solutions for long-term waste management.
Explanation:
Answer:
The major challenges facing the nuclear industry include ensuring power plant safety, protecting reactors from natural disasters and external aggression, and finding effective solutions for long-term waste management.
Have a nice day!
Identify one food chain in this ecosystem.
Answer:
Sun -> Grass -> Beetle -> Blue Jay
Sun, Grass, Worms, Woodpecker
Of the phenomena that correlate with the data above, the one that is the most direct consequence of the trend in air travel is the increase in the spread of infectious diseases the increase in the spread of infectious diseases A the increase in urban sprawl the increase in urban sprawl B the decrease in biodiversity the decrease in biodiversity C the increase in hypoxic aquatic ecosystems the increase in hypoxic aquatic ecosystems D the decrease in the total fertility rate of developed nations
Answer: the increase in the spread of infections diseases
Explanation:
got it right
The increase in the spread of infectious diseases are the most direct consequence of the trend in air travel. So, the correct option is A.
What are Infectious diseases?Infectious diseases are defined as disorders that are caused by organisms such as bacteria, viruses, fungi or parasites. Many organisms live in and on our bodies which are generally harmless or even helpful but some organisms can cause disease. Some infectious diseases can spread from person to person.
Infectious diseases can be viral, bacterial, parasitic or fungal infections a rare group of infectious diseases known as transmissible spongiform encephalopathy (TSE). The increase in the spread of infectious diseases are the most direct consequence of the trend in air travel.
Therefore, the correct option is A.
Learn more about Infectious diseases, here:
https://brainly.com/question/11478894
#SPJ6
Your question is incomplete, most probably the complete question is:
Of the phenomena that correlate with the data above, the one that is the most direct consequence of the trend in air travel?
A. the increase in the spread of infectious diseases
B. The increase in urban sprawl
C. the decrease in biodiversity
D. the increase in hypoxic aquatic ecosystems
E. the decrease in the total fertility rate of developed nations
When a squirrel hears a strange noise that might indicate the presence of a predator, fight-or-flight hormones are released into its system. The hormones help prepare the squirrel's body to do strenuous physical activities, like quickly climbing up a tree, more efficiently. Which statement describes how two organ systems work together to help a squirrel respond to a possible external threat?
Answer:
The flight-or-flight hormones are released by the endocrine system in response to environmental changes detected by the nervous system.
Explanation:
yes
A bee gets nectar from a flower and the flower gets help with pollination. Both benefit, so the symbiotic relationship is _______________.
Competition
Commensalism
Mutualism
Parasitism
I NEED THIS ASAP
Which indicates what happens to the kinetic energy when the mass of a moving object increases?
A. The kinetic energy does not change
B. The kinetic energy increases by the same factor as the mass increase
C. The kinetic energy increases by the square of the same factor as the mass increase
D. The kinetic energy decreases by the same factor as the mass increase
Answer:
C. The kinetic energy increases by the square of the same factor as the mass increase
Explanation:
As the object moves faster, potential energy goes down and kinetic energy increases.
I generally remain in the nucleus what am I DNA, RNA, or both?
Answer:
DNA
Explanation:
Help!!! please!! this test is timed!! I will give brainliest!!!
What is a system?
2 points
The solid rock part of Earth, including mountains, valleys, continents, and all of the rock beneath the oceans
The set of all water on the earth's surface, such as lakes, seas, and oceans
A group of related parts that all work together to perform a specific function
The greenhouse gases that help keep the earth at a temperature where water is in liquid form
Answer:
A group of related parts that all work together to perform a specific function
Explanation:
A. Producer
B. Primary consumer
C. Secondary consumer
D. Tertiary consumer
Answer:B. Primary consumer
Explanation:The reason why Its b because that primary comsumers are mostly herbivores or the primary comsumer is the first consumer to eat the producer.Hope it helps!
_____ is a group of similar organism that can mate with each other and can make fertile offsprings
Answer:
A species is a group of similar organisms that can breed with one another to produce fertile offspring.
Explanation:
For example, humans are one species and dogs are another species. Individuals of the same species can reproduce to make more individuals of the same species.
Answer:
A species
Explanation:
What factors do you need to know in order to calculate a region's population growth
1)What does the term Science means to you as a student?
Answer: 1 : knowledge about the natural world that is based on facts learned through experiments and observation. 2 : an area of study that deals with the natural world (as biology or physics)
Explanation:
Answer:
Death and Boredom
Explanation:
Approximately time passes between B and F
Answer:
14 days
Explanation:
It takes 27 days for the moon to make a full rotation around the earth. Because half the of the rotation around the earth has been made, half 27. Half of 27 is 13.5, so the time between B and F is approximately 14 days.
The current genetic code evolved Please choose the correct answer from the following choices, and then select the submit answer button. Answer choices before the common ancestor of all extant life. after the common ancestor of all extant life but before eukaryotes split from the other domains of life. after eukaryotes split from other domains of life but before the split of multicellular animals and multicellular plants. after the split of multicellular animals and multicellular plants but before the common ancestor of chordates. after the common ancestor of chordates.
Answer:
before the common ancestor of all extant life.
Explanation:
Genetics can be defined as the scientific study of hereditary in living organisms such as humans, animals and plants.
Heredity refers to the transfer of traits (specific characteristics) from the parent of a living organism to her offspring through sexual reproduction or asexual production. Some examples of hereditary traits are dimples, tongue rolling, baldness, handedness, freckles, curly hair, color blindness, height, etc.
Basically, deoxyribonucleic acid (DNA) is an organic complex-molecular structure found in all living organisms. It comprises of genes and is essentially the foundation block of all living organisms such as humans, animals and plants.
The current genetic code evolved before the common ancestor of all extant life i.e that are still in existence or alive.
Which option describes the function of RNA polymerase?
Select one:
Carrying amino acids to the transcription site.
Moving mRNA strands into and out of the nucleus.
Splitting the DNA double strand into two single strands.
Forming an RNA strand using a DNA strand as a template.
Answer:
brown
Explanation:
have you pooped today?
The option which describes the function of RNA polymerase is that it forms an RNA strand using a DNA strand as a template. Thus, the correct option for this question is D.
What is RNA polymerase?RNA polymerase may be defined as a multi-unit enzyme that synthesizes RNA molecules from a template of DNA through a process called transcription. This enzyme is responsible for copying a DNA sequence into an RNA sequence, during the process of transcription.
RNA polymerase binds to DNA, separates the strands, then uses one of the strands as a template from which to assemble nucleotides into a complementary RNA strand.
It uses a single-stranded DNA template to synthesize a complementary strand of RNA. Specifically, RNA polymerase builds an RNA strand in the 5' to 3' direction, adding each new nucleotide to the 3' end of the strand.
Therefore, the option which describes the function of RNA polymerase is that it forms an RNA strand using a DNA strand as a template. Thus, the correct option for this question is D.
To learn more about RNA polymerase, refer to the link:
https://brainly.com/question/15872478
#SPJ2
⚠️HELP⚠️
UV rays, chemicals, radiation, and tobacco products are all agents known to cause cancer because they can cause the DNA in cells to be incorrectly transcribed, therefore continuously making a
protein. What are these agents caffed?
Pollution
A
B
Mutagens
С
Polypeptides
D
Anticodons
Based on the information given in the chart, which kingdom most likely has the highest percentage of photosynthesizing organisms? A. Eubacteria B. Animalia C. Plantae D. Fungi
Answer:
The answer is C. in other form Kingdom Plantae its C
Speciation means the formation of a new species.
True
False
Answer:
true
Explanation:
Definition: Speciation is the process by which new species form. It occurs when groups in a species become reproductively isolated and diverge.
Answer:
true because it means the formation of a new plant or animal species
Please complete the following DNA strands
1. AGGTCCAAGCTCAAATTTCCCC
2. GAAACCCCTTAAACCTTAATTCC
3. GCGCGCGCAAATTTTTCCCATCT
Please complete the following strands using RNA:
1. AGGTCCCAAAGGCCCTTTCC
2. UAAAGGGCCCAGCCCACC
3. CUAAAAGGGGGUUUUAACC
Seventy percent of the plants containing chemicals useful for cancer treatment are found only in rain forests. What type of ecosystem service do these plants provide ?
Answer: The type of ecosystem service these plants provide is PROVISIONING SERVICES.
Explanation:
Ecosystem services is defined as the activities that occurs in an ecosystem which directly or indirectly enhance the well being of humans. They are grouped into four different categories which include:
--> Regulating services
--> cultural services
--> supporting services and
--> provisioning services
The PROVISIONING SERVICES obtained from the ecosystem are any benefits or products that can be gotten from nature. These include:
--> food
--> drinking water
--> wood fuel
--> natural gas
--> medicinal resources (gotten from herbal plants which can be used to manufacture drugs for cancer treatments).
Explain why it is still an evolutionary advantage to produce flowers in
plants.
Answer:
Those specialized flowers are able to attract organisms to help pollinate and distribute seeds. Another cool advantage is the fruit/seed packaging.
Need the answer quick pls thanks
The cactus has a specialized fleshy stem that is specialized to store water for long periods of time. Which plant tissue most likely makes this action possible?
I know the answer is Ground, but i need to know WHY the answer is ground tissue. I WILL MARK BRAINLIEST
(on EDGE)
Answer:
If I were to guess its probably Vascular
Explanation:
Cactuses can store water nearly four months mainly in the winter and watering is not required for them frequently during that time. The stem acts as a reservoir for the amount of water it holds. The ground tissue of cactus has lots of parenchymal cells that store water.
What is parenchyma?The ground tissue system comes from a ground meristem which has three tissues, namely parenchyma, collenchyma, and sclerenchyma.
The ground tissue of cactus has many parenchyma cells that store water.
Thus, it can be concluded that the ground tissues helps cactus to store water for a long time.
For more details regarding ground tissue, visit:
https://brainly.com/question/346979
#SPJ2
an energy-producing organelle found in nearly all cells of plants and animals.
Answer:
Mitochondria
Explanation:
Mitochondria is and energy kinda like a battery and cells have thousands of mitochondria. Hope this helps :)
A chewing insect damages the vascular tissue of a plant system. This damage will most directly affect the
Answer:
Conduction of water and minerals between the roots and leaves
Explanation:
- EIjiro
*EXTRA POINTS*
A person pushes the same box with the same amount of force on 3 different surfaces. Which surface exerts the most friction on the box?
Answer:
Surface A.
Explanation:
The box stops faster than other surfaces here.
This means the surface applies greater frictional force to the box conpared to others.
How does carbon dioxide and
water enter the plant?
Answer:
CO2 through the leafs and H2O through the roots
Explanation:
CO2 enters through the stomata and the water gets into the plant through the roots and goes up the plant through capillary action.
Answer:
co² enters the plant by stomata where as the water enters through roots when we watered the plant
What is an antibiotic? Which class of antibiotics works best for Bordetella pertussis?
You can download answer here
tinyurl.com/wpazsebu
Alex wants to know if a fossil he found was closely related to cats. some likely features of the fossil that can help him reach a conclus Check all that are true.
A. Bone Structure
B. Blood
C. Tissue
D. Skull Shape
Answer:
A and D
Explanation:
A fossil is made of bones and it's the dead version of the animal, therefore it has to be A and D as blood and tissue have already rotted away.
I hope this helps you!! ^-^