Free BRAINLYEST "ANSWER ONLY IF U WANT IT"

Answers

Answer 1

Answer:

I do__________________

Answer 2

Answer:

I do

Explanation:


Related Questions

What evidence does the cladogram provide

Answers

A phylogeny is a hypothesized relationship between groups of creatures that is represented by a cladogram. A scientist investigating phylogenetic systematics uses a cladogram to depict the groups of species being studied, their relationships, and their most common ancestors.

18.
Which of the following organisms are
producers?
A. humans
B. bears
C. trees
D. fungi
19.

Answers

Trees are producers

I hope this helps

Answer:

Trees

Explanation:

Trees are the only thing on the list that does nothing but help the environment/produce. Its not fungi because fungi is literal harmful bacteria that molded.

Question 8 of 10
The molecules that make up food contain energy. How does the human body
get energy from the food molecules?
A. By adding energy to the molecules
B. By breaking and reforming chemical bonds in the molecules
C. By using them to form ionic bonds
D. By combining the molecules together

Answers

Answer: B.) By breaking and reforming chemical bonds in the molecules.

Explanation:

differences between the structure of the wall of the stomach and the structure of the wall of the ileum​

Answers

Answer:

Wall of stomach : it has three layers of muscle instead of two. Under these muscle layers is the adventitia, layers of connective tissue continuous with the omenta. The epithelium of the stomach forms deep pits, called fundic or oxyntic glands.

wall of ileum : The wall itself is made up of folds, each of which has many tiny finger-like projections known as villi on its surface. The ileum has an extremely large surface area both for the adsorption of enzyme molecules and for the absorption of products of digestion.

match the vocabulary word with the correct definition


reaction that needs oxygen

Monosaccharide used at the beginning big cellular respiration

useable cell energy

An organelle that produces ATP through cellular respiration

Reaction that does not need oxygen


VOCAB
1. Mitochondrion
2. ATP
3. Glucose
4. Aerobic
5. Anaerobic ​

Answers

Answer:

1. mitochondrion to an ATP through cellular respiration

2. ATP to unseable cell energy

3. glucose to monosaccharide used at the beginning big cellular respiration

4. aerobic to reaction that needs oxygen

5. anaerobic to action that does not need oxygen

PLEASE HELP WILL GIVE BRAINLIST!

A population of rhinos in Africa is 112. this year there were 17 births and eight deaths in the population. What is the change in population? Do we have a positive, negative, or zero change in population? How many members are in the new population?

Answer should contain the following information: work for calculating the change in population positive, negative, or zero change in population. work for calculating the new population

Answers

Explanation:

Why anti-poaching?

Rhinos have inhabited the African continent for over a million years and they play a huge role in their ecosystems. The illegal trade in powders made from their horns, which in some countries in Asia is still considered a medicine or simply a symbol of wealth, nearly led to the extinction of the African rhino.

In 1875, there were still more than 1,000,000 rhinos living in the vast grasslands of Africa. Today the populations of the two species of black rhino and white rhino are estimated to contain about 5,000 and 20,000 animals respectively. The senseless killings continue. Since 2007, the number of rhinos hunted in Africa has increased by almost 9,000%.

It is therefore our call to stop the slaughter of rhinos with all our might.

Are there any parts of the human body that get oxygen directly from the air and not from the blood?

Answers

Answer:

The Cornea

is the answer

what happens when a vacuole releases its store of water?

Answers

If the central vacuole in plants cell loses its water then the plant will plasmolyse or deflate.

How does your body respond to a decrease in blood glucose

Answers

Answer:

When blood sugar drops too low, the level of insulin declines and and other cells in the pancreas release glucagon, which causes the liver to turn stored glycogen back into glucose and release it into the blood. This brings blood sugar levels back up to normal

Help me please!!!!! ASAP!!! ​

Answers

Answer:

Noncyclic photophosphorylation (top) and cyclic photophosphorylation (bottom). These processes are better known as light reactions.

Glycolysis produces 2 ATP molecules, and the Krebs cycle produces 2 more. Electron transport from the molecules of NADH and FADH2 made from glycolysis, the transformation of pyruvate, and the Krebs cycle creates as many as 32 more ATP molecules.

I'm not sure if that'll help you, but yuhhh!

Explain step by step or in simple terms how does the body regulate water ​

Answers

Answer:

The kidneys can regulate water levels in the body; they conserve water if you are dehydrated, and they can make urine more dilute to expel excess water if necessary. Water is lost through the skin through evaporation from the skin surface without overt sweating and from air expelled from the lungs.

In an ecosystem, a deer consumes grass. What percentage of energy will the deer acquire from the grass? 0. 1% 1% 10% 100%.

Answers

In an ecosystem, the energy is transferred between the organisms participating in the food webs from producers and consumers.

The percentage of energy transferred to the deer after feeding on the grass is 10%.

The 10% law of the energy states that:

1. The food chain at each trophic level passes or transmits only 10% of the energy and 90% of the energy is lost as heat.

2. The amount of energy at each trophic level decreases, such that the producers if consuming the 100 J of energy, the deers or primary consumers at the first trophic level will have only 10% of the energy.

Thus, the deer will possess only 10% of the energy at each trophic level, following the 10% law.

The correct answer is Option C.

To know more about 10% law, refer to the following link:

https://brainly.com/question/1367643?referrer=searchResults

what do you waste the most of and how could you repurpose it into something that is beneficial?

Answers

Answer:I dont know

Explanation:

You see, the explanation of me not knowing is that my brain cells have died over the years and i do not know what to do with my life:)

The only system that does not pass through the thalamus on its way to the cerebral cortex is the __________ system. A. Tactile B. Gustatory C. Olfactory D. Visual.

Answers

The cerebral cortex process the information delivered by the thalamus, the information is related to the senses.

The only system that does not pass through the thalamus on its way to the cerebral cortex is the olfactory system.

The systems that pass through the thalamus are:

1. The visual sensation or information passes through the visual occipital cortex. It then delivers the information from the thalamus to the cerebral cortex.

2. The gustatory cortex is the region of the cerebral cortex, which is responsible for the senses of tastes and flavor. It also passes through the thalamus on its way to the cerebral cortex.

3. The tactile system includes the senses of touch. It is the information received through the receptors present on the skin. It also delivers the information to the cerebral cortex via the thalamus.

4. The olfaction system is not involved in the thalamus pathway. The olfactory cortex is present in the temporal lobe, which is not routed through the thalamus.

Thus, the correct answer is Option C.

To know more about the olfactory system, refer to the following link:

https://brainly.com/question/7500611

Answer:

C. Olfactory

Explanation:

In the area illustrated, what process is evident over time?

Answers

In the area illustrated in the image attached, the biological process which is evident over time is: ecological succession.

Ecology can be defined as the scientific study of the relationship existing between living organisms such as plants and animals with respect to their physical and biological environment (abiotic factor).

In Ecology, ecological succession refers to a process through which the structure of an ecological (biological) community evolves or changes over time.

Generally, there are three (3) main types of ecological succession and these include:

Primary successionSecondary successionCyclic succession

From the ecological (biological) community illustrated in the image attached, we can deduce that there is an evolution (change) in the species of plants growing over time. This ranges from weeds during the first visit to pine and oak trees during the seventh visit.

Read more on ecological succession here: https://brainly.com/question/5187022

what is the relationship between the photosystems and the calvin cycle

Answers

What is the relationship between the photosystems and the Calvin cycle? The photosystems transfer energy to the Calvin cycle through ATP and NADPH.

I hop this helps! :)

What part of the microscope give us a sharper image?
a
micro or fine focus
macro focus
light source
on/off button

Answers

I’m pretty sure it’s macro focus.

Your friend says that every material can be classified as either good conductor or a good insulator. Is your friend correct? Write a sentence to explain why you agree or disagree?

Answers

Answer:

Your friend is correct. Materials such as copper are good conductors, but poor insulators. However, rubber is a good insulator and a poor electrical and heat conductor.

What is the term used to describe when a molecule moves into the cell through a
transport protein but does not require energy to do so?
a) facilitated diffusion
b) osmosis
c) active transport
d) filtration

What’s the correct answer

Answers

A) facilitated diffusion :)

In Mendel's experiments with pea plants, the allele for tall pea plants was dominant and the allele for short pea plants was recessive. When did Mendel see short pea plants?

A. when the plants had two dominant alleles for height

B. when the dominant allele for tall plants was not present

C. when the plants had both a dominant allele and a recessive allele

D. when the pea plants produced yellow seeds
PLS HELP!

Answers

Answer:

B

Explanation:

if the reccesive trait is what you want then you cannot have any dominant alleles present

proteins are responsibe for

A.) insulating the body
B.) Maintaining the structure of cells and tissue
C.) Storing energy from unused glucose molecules
D.) Holding the blueprints that code for all the cell's activities

Answers

Answer:

B.

Explanation:

Answer:

its a.

Explanation:

im learned protiens in biology like 4 weeks ago.

(ID Level 18
OC
I start with "e"end with "e".
have whole countries inside
me. What am I?

Answers

Answer:

Europe

Explanation:

why is biodiversity in a certain environment important?


pag tama ung answer i brainliest you

Answers

Answer:

That's right. You have listed important determinants and features of biodiversity.

Explanation:

Pa fallow po pls.

No clue dude tuff luck my guy

We would expect cells found in the active muscles of animals to contain relatively large amounts of which cellular organelle? A) centrioles B) mitochondria Eliminate C) lysosome D) nuclei

Answers

Answer: B.) Mitochondria

Explanation:

should the nation of warring wizards be considered a nation. why or why not

Answers

Answer: no

Explanation:

The nation of Warring Wizards should not be considered a nation because they all live in different places and only 2 of them speak Russian.

Which of the following best describes chemical weathering? A process in which ice wears away at rocks over a long period of time O A series of changes that moves rocks from one area to another O Any small-scale event such as rain or fog O A process that changes the composition of rocks, causing them to break down.​ PLEASE HELP ME NOW.

Answers

the erosion or disintegration of rocks, building materials, etc., caused by chemical reactions (chiefly with water and substances dissolved in it) rather than by mechanical processes. HOPE THIS HELPS!! :)

A community in which populations of plants and animals remain stable and exist in
balance with each other and the environment

Answers

Answer:

ecological community

Explanation:

A climax community is the final stage of succesion

How does a forest fire impact a population of birds that nest in the trees.

Answers

Answer:

If a forest fire occurs it will impact a population of birds that nest in those trees because their habitat will be burnt down. This will provoke the birds to find a new habitat which can be hard if the entire forest is burnt down. Additionally resources such as food will be burned down as well.

Assuming birds escape a fire, smoke might still affect their health in ways that aren’t very well understood. Scientists have found that smoke can damage lung tissue and leave the animals susceptible to potentially lethal respiratory infections.

5. In a tundra ecosystem, the carrying capacity for arctic hares is about 400 individuals. Which of these events is MOST likely to reduce the carrying capacity for arctic hares in the ecosystem by at least 25 percent?

(A) a severe storm that kills about 100 adult and young arctic hares

(B) a 25 percent decrease in the populations of foxes, wolves, or other predators of arctic hares

(C) the arrival in the ecosystem of a species that competes with the arctic hare for its food

(D) a temporary increase in the arctic hare population to more than 425 individuals

(E) a mutation that introduces a new fur color to the arctic hare population

Answers

A temporary increase in the arctic hare population to more than 425

individuals.

Hares are among the primary consumers as they are herbivores while foxes

are  secondary consumers which feeds on the hares.Foxes will hunt the

hares for food which will drastically reduce their population

Increasing their population by 425 individuals with the hares having a

population of 400 will surely decrease their carrying capacity in the tundra

ecosystem.

Read more about Ecosystem on https://brainly.com/question/842527

DNA ___________ is important because it ensures that when a cell divides, the two resulting cells have the same genetic code. Pleaseee help

Answers

Answer: Replication

Explanation: When the cell is preparing to divide it will replicate its DNA so that both of the daughter cells will have a complete set of the DNA. It's like a book of instructions and the cell has to perfectly replicate it so that when it splits into two both of the new cells will have a perfectly made copy of it! Hope this helps :)

Other Questions
In __________ ribosomes can attach to the mRNA and begin translation even though transcription has not been completed. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Is the graph increasing, decreasing, or constant?A. ConstantB. DecreasingC. Increasing Plant and animal cells are both eukaryotic. This means they...O Have a nucleusO Contain DNA and RNA.O Can reproduce on their own. in what year was the first aicpa conference on current sec developments held? what does the suffix ition mean in the word composition HELPPPPP PLSSSS WILL GIVE BRAINIEST!!!!! did thomas jefferson agree with the federalist papers? pls write a paragraph plssss Like the success of animals, the success of plants is limited based on the resources available to each individual. In the tropicalrainforest, plants are especially limited by the spate they have available to grow and reproduce. Which of these statementsdescribes a way that limited space will impactthe success of a plant in the rainforest? (SC.7.L.17.3)A plant without enough space will face increased predation from herbivoresaO A plant without enough space will not have as many parasites and diseases.3A plant without enough space will be more likely to be impacted by air qualityA plant without enough space will not be able to capture enough light to grow. Why do some atoms form chemical bonds while others do not? How did the Spanish-American war aid the U.S. in becoming a global power? Which is the best inference from the author's statement that world war ii ""ended the great depression""? the best inference from the author's statement is that. pleeeeease help meeeeeee perfectly competitive market in long run equilibrium. if demand decreases, we can be certain that price will Which of these statements about game design is FALSE?Game design involvesincorporating user feedback toimprove the platform.Games design is not a STEMcareer because it is just aboutmaking entertainment.Game design is iterative.Game design requires many teammembers with lots of differentareas of expertise. Ocupo poner Palabras homfonas. Activity 3.Direction. Name the ratio as a fraction in simplest form.1. P5.00 to P60.002. 1 hour to 40 minutes3. 2 weeks to 4 days4. Eight out of 30 passengers are tourist. Give the ratio of tourist to passengers.5. For every 45 passengers, 9 are foreigners. Write the ratio of foreigners topassengers.Please answer please help me HELP QUICKLY Why are the deepest high tides so deep and the shallowest low tides so shallow? Hint: how are the Earth, Sun, and Moon aligned? 1 What is the universe made of? ...2 How did life begin? ...3 Are we alone in the universe? ...4 What makes us human? ...5 What is consciousness? ...6 Why do we dream? ...7 Why is there stuff? ...8 Are there other universes? 3. West Fremont is a community consisting of 3,000 homes. A small coal-burning power plant currently supplies electricity for the town. The capacity of the power plant is 12 megawatts (MW) and the average household consumes 8,000 kilowatt hours (kWh) of electrical energy each year. The price paid to the electric utility by West Fremont residents for this energy is $0.10 per kWh. The town leaders are considering a plan, the West Fremont Wind Project (WFWP), to generate their own electricity using 10 wind turbines that would be located on the wooded ridges surrounds the town. Each wind turbine would have a capacity of 1.2 MW and each would cost the town $3 million to purchase, finance, and operate for 25 years.(a) Assuming that the existing power plant can operate at full capacity for 8,000 hrs/yr, how many kWh of electricity can be produced by the plant in a year?(b) At the current rate of electrical energy use per household, how many kWh of electrical energy does the community consume in one year?(c) Assuming that the electrical energy needs of the community do not change during the 25-year lifetime of the wind turbines, what would be the cost to the community of the electricity supplied by the WFEP over 25 years? Express your answer in dollars/kWh. I NEED HELP!!!!!4. Three bags of Skittles and two bags of M&M'sweigh 3 pounds. Four bags of Skittles weigh 3pounds. All bags of skittles weigh the same, andall bags of M&M's weigh the same. What is theratio of the weight of a bag of Skittles to a bag ofM&M's?