Transcribe the following Strand of DNA:
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Answers

Answer 1

Answer:

CCGATAGGT

Explanation:

got this for my hw.

Answer 2

Answer:

So the central dogma of molecular biology describes the journey from DNA to protein product:

DNA --transcription--> mRNA --translation--> Protein

Assuming the DNA sequence provided is the template strand (rather than the complimentary coding strand), we start by transcribing the sequence into mRNA starting on the 3' end of the DNA towards the 5' end (which would build the mRNA 5' to 3'). This process involves the enzyme "RNA polymerase," which can only add nucleotides to the 3' end of the mRNA, just like how DNA polymerase can only synthesize DNA in the 5' to 3' direction. The RNA polymerase will bind to the template DNA strand and synthesize the complimentary mRNA, substituting uracil for thymine (since RNA does not contain thymine like DNA).

In terms of transcribing the sequence given to you, we'll have to work backwards + flip it around to get the 5' to 3' mRNA since the DNA is given 5' to 3' rather than 3' to 5'. Due to the length and the fact that we'll have to use triplets in translation anyways, it can help to break the sequence into triplet codons now.

5’-AAG | TTA | ATG | AGA | AAT | CGA | CAT | GGG | GCG | CCG | AAA | GTA | TAA | CCG | TCT | TAG | AAT | AGC-3’

We can then cross out each codon as we transcribe it and flip the sequence to be 5'-3' mRNA:

mRNA: 5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Normally, mRNA sequences start with "AUG" which is the start codon (and codes for Methionine), but I'll assume this is just for practice translating + transcribing in general. There's also a stop codon before the end but I'll assume the same again.

Translation involves three main steps - initiation, elongation, and termination. Initiation involves the translation ribosome assembling around the mRNA starting at the 5' end start codon, and tRNA carrying an amino acid binding to the complimentary section of the mRNA. As each tRNA attaches and the ribosome moves along the mRNA, the amino acids on each tRNA are bonded into a longer and longer peptide chain and the now amino acid-less tRNA are ejected (elongation). Termination occurs when a stop codon is reached, the ribosome will end elongation and help fold the protein into its final structure.

To translate the mRNA sequence here we'll need an amino acid/mRNA codon chart. I don't believe I can attach an image here, but looking up those exact words should yield the right results in images.

5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Ala - Ile - Leu - Arg - Arg - Leu - Tyr - Phe - Arg - Arg - Pro - Met - Ser - Ile - Ser - His - STOP - Leu

Amino acids are often abbreviated into three letters (Ala = alanine, Met = methionine, etc), and sometimes are abbreviated as single letters, though I've only seen that for sequencing databases.

In terms of locations for each of these processes, transcription occurs in the nucleus for eukaryotes and translation in the ribosomes/cytoplasm.

Explanation:

n


Related Questions

What designs the shape and size of all animals that are multi-cellar and have a back-bone

Answers

Answer

Environmental pressures

Basically every animal adapts to pressures from their environment in different ways, causing them to have different shapes and sizes

What is something you can never seem to finish?

Answers

Answer:

This!! HAHAHA!

Explanation:

Cows, buffaloes and wildebeest are closely related enough that the same disease can harm all of them true or false

Answers

False
Should be the right answer because we can see mutations in humans can kill some and do nothing to others

8. If brown (B) noses are completely dominant to blue (b) noses, write
genotypes combinations and phenotypes you could have in any given individual.

Answers

BB - brown nose, Bb - brown nose bB - brown nose and bb - blue nose.

15. Stephanie made the following chart for the terrestrial planets. What correction needs to be made?
Mercury
Venus
Earth
Mars
no atmosphere
very thick atmosphere
medium atmosphere
no atmosphere
1st planet
2nd planet
3rd planet
4th planet
1 year is shorter than Earth's year.
1 year is short than Earth's year.
1 year is approximately 365 days.
1 year is longer than Earth's year.
O Mars's year is shorter than Earth's year.
O Mercury's year is longer than Earth's year.
A
O Mars has a thin atmosphere
O Earth is the 2nd planet and Venus is the 3rd.

Answers

Answer:

c. mars has a thin atmosphere

Explanation:

i hope that helps even though its a few days late

How and why does the surface of the earth change
of the earth has changed?

Answers

Answer:

How and why does the surface of the earth change

of the earth has changed?

It can be hard to describe change on the surface without bringing up the interior. Earth is a system of constantly changing interactions between interior, surface conditions, and external events.

Volcanoes bring up new material and even create land. The Hawaiian islands, for instance are a chain of volcanoes on the surface, but the underlying structure is a single magma plume. In a way, the entire chain of islands is a single volcano that breaks through different places as the crust moves over it.

On that note: plates. Earth is made of tectonic plates that constantly move. Some grind against one another, others collide, and some pull apart. Depending on direction and interaction, you get anything from mountains, to spreading valleys, oceans, and anything else you care to name. Mountains can almost be viewed as something akin to the ridges of build up ice on a window scraper.

Erosion by water, wind, sand, chemicals, and living things changes the surface too. Materials on the surface face an incredible number of forces breaking them down and dragging them away, even as those same forces in different places and situations deposit those materials in other places, building things back up.

“Stardust” is also a thing. Rocks, dust, debris, and all sorts of random, natural cra.,p is constantly hitting our atmosphere. Regardless of whether or not it stays mostly intact, some material breaks off, and most of it does tend to make it to the surface, adding tiny amounts of matter all the time. …of course something BIG enough hitting the surface can throw rocks and chunks of surface clear into space, so that’s a thing too.

Remember when I mentioned living things? Living things D.,IE! Gac.k! And when they do, they break down into organic gunk. Soil - the stuff we grow crops in - is basically minerals and dead things that are decaying into nutritious, yummy, dir.,t.

Weather changes things too. Rain erodes, but rain that soaks a rock, and then is frozen by low temperatures, breaks the rock. Too much rain can create flooding, which results in a lot of sediment moving downstream. Heat can dry things out, crack the ground, and even slowly cook one kind of soil into another. Lightning can make glass out of sand, snow can collapse weak ground, not enough rain can dry out ground that could si.nk down without the extra pressure, and too much rain can literally move mountainsides if enough water adds its weight to the rocks and dir.t.

It’s always changing, and there is always more complexity to go into when studying it. There’s seldom a single cause, or reason, or effect for anything.

Explanation:

Have a great day!

The surface of the earth is constantly changing.

Explanation:

Wind, water,and ice break down large rocks and move sediments on the surface. Some events, though, change earth's surface much more quickly. These include volcanic eruptions, earthquakes, and landslides.

My parents are tall but I’m short am I adopted???

Answers

Answer:

Nope. You get your height genes from both sides of your family - and you can end up taller or shorter than either or both of your parents. You never know if some of your ancestors might have contributed genes.

Hope this Helps!

-Lexie

65 points, anwser asap, graph below

What is happening to the deer population between the years 2005 to 2010? Support with reasoning from our model of population growth.

Answers

Answer:wolves

Explanation:

wolves decreased the population because they kept increasing so people killed the and a couple of years later they went up the so they brought wolves back!

Animals do not have inner feelings that tell them when to eat.


True or False

Answers

Answer:

true

Explanation: because if they did then that would be crazy, its like how would they have feelings that tell them what to eat and what not to eat, yk what i mean? im sorry if this is wrong.

Which two statements best describe jet streams in the northern hemisphere?
A. The subtropical jet stream separates warmer air near the equator
and cooler air to the north.
B. The polar jet stream separates colder air near the pole and
warmer air to the south.
C. The subtropical jet stream causes ocean currents to form near
the equator.
A
D. The polar jet stream circulates air between the North Pole and the
South Pole.
SUBMIT

Answers

The correct answer is B. In the Northern Hemisphere, the polar jet stream separates colder air near the pole and warmer air to the south.

The jet stream is a geophysical effect caused by the large temperature difference between the north pole and the equator. Something similar also happens on a small scale. In summer, when night falls and the ground cools where the sun is gone, air blows from north to south across the boundary between warm and cold air. This is the refreshing evening breeze.

From the north, a jet stream generally supplies colder air than from the west or south. The jet stream also creates depressions with a warm front and a cold front.

Learn more about jet streams in https://brainly.com/question/861519

Answer:

A. The subtropical jet stream separates warmer air near the equator

and cooler air to the north.

B. The polar jet stream separates colder air near the pole and

warmer air to the south.

Explanation:

why do fungi release enzymes from there tips?​

Answers

Answer:

They absorb the food molecules that result from the external digestion.

Explanation:

Sand is a type of mixture A mixture is a _____

Answers

Answer:

heterogeneous mixture

Answer:

sand is a Heterogeneous mixture. Heterogeneous mixture has two or more chemical substances.

A mixture is a material made up of two or more different chemical substance/substances which are not chemically combined!

Explanation:

hope this helped ^_^

Cell division vocabulary .

Answers

Answer:

Chromosomes-a threadlike structure of nucleic acids and protein found in the nucleus of most living cells, carrying genetic information in the form of genes.  

Chromatin-the material of which the chromosomes of organisms other than bacteria are composed. It consists of protein, RNA, and DNA.

Chromatid-each of the two threadlike strands into which a chromosome divides longitudinally during cell division. Each contains a double helix of DNA.

Centromere-the region of a chromosome to which the microtubules of the spindle attach, via the kinetochore, during cell division.

Centriole- a minute cylindrical organelle near the nucleus in animal cells, occurring in pairs and involved in the development of spindle fibers in cell division.

Explanation:

Plzzzz help Creating models to examine concepts is important in science. Some of these are experiments
and only one is a model. Which one is a model?
a
O A heated soda can is cooled rapidly to see what will happen to air pressure.
O An apple is sectioned into quarters to represent the ratio of water to land on Earth.
O Ice cubes are left to melt on different surfaces to find out how materials conduct heat.
O Students conduct a color blindness test with their family members.

Answers

Knowing that a model is considered a representation of something, the correct option is option B, in which the apple represents the Earth. An apple is sectioned into quarters to represent the ratio of water to land on Earth.

--------------------------------

To answer this question, you can think about a model as a representation of something.

A scientific model can represent an object, a system, a process, a phenomenon, etcetera.

Models are used to explain, predict, or describe natural events. They constitute a significant tool in modern science and are essential to scientific practice.

Knowing this, among the provided options, the one that is a model is option B.

The apple is representing the ratio of water to land on Earth. It is a representation of the earth.

All the other options are experiments performed to see what is going to be the result.

---------------------------------

You can learn more about models at

https://brainly.com/question/14281845

https://brainly.com/question/19426210

https://brainly.com/question/1853568

Drag each tile to the correct location.
Match each process to where it occurs in the carbon cycle.

Answers

Answer: In order:

1. Ingestion

2. Decomposition

3. Fossilization

4. Combustion

Explanation:

Examine the food web below. Suppose the local government sprayed a pesticide to kill mosquitoes. The sparrows ate the poisoned mosquitoes and died as well. What would most likely happen to the organisms in this food chain after the sparrows began to disappear?
A.
There would be an overpopulation of caterpillars, which would threaten the oak trees.
B.
The sparrows’ disappearance would not affect the other organisms in the ecosystem.
C.
Most of the organisms in the ecosystem would starve and die.
D.
The eagle would loose its primary food source and be forced to start feeding on mountain lions.

Answers

Answer:

A. There would be an overpopulation of caterpillars, which would threaten the oak trees

Explanation:

Because sparrows eat caterpillars as a primary food source, when the population of sparrows decrease, the population of caterpillars will increase. Because of this, more caterpillars will be feeding off of the oak trees, therefore threatening the oak trees. I hope this helps!

What structures are found in all cells? select two options

Answers

You’ll need to attach an image showing the choices or type them. But structures that are found in both plant and animal cells include the cell membrane, ribosomes, cytoplasm, and DNA.

3
A
C
9
12
15
What do the dotted lines, indicated with the arrow, represent in the DNA model above? (B.6A)

Answers

Answer:

[tex]\fbox\red{question\:given}[/tex]

[tex]\blue{what \:is\: photosynthesis}[/tex]

[tex]\huge\fbox\red{Answer↓}[/tex]

[tex]the \: process \: by \: which \: green \: plants \: \\ turn \: carbon \: dioxide \: and \: water\\ \: into \: food \:using \: energy \: \\from \: sunlight.[/tex]

Hydrogen bonds between guanine and cytosine


What is a plant produced from a cross between two plants with different genetic constituents called

Answers

Answer:

What is a plant produced from a cross between two plants with different genetic constituents called hybrid plant.

Hybrid is a plant produced from a cross between two plants with different genetic constituents.

WHAT IS A HYBRID?

A hybrid is an individual organism produced from a cross between two parent organisms with different genetic constituent.

For example, a mule is a hybrid formed from a cross between a horse and a donkey.

Therefore, a plant produced from a cross between two plants with different genetic constituents is called hybrid.

Learn more about hybrid at: https://brainly.com/question/13978941

What is the difference between refraction and reflection?

Answers

Answer:

Reflection involves a change in direction of waves when they bounce off a barrier. Refraction of waves involves a change in the direction of waves as they pass from one medium to another.

Explanation:

Ayúdenme plssssss y les doy puntos

Answers

Answer:

plato b

Explanation:

Answer:

photosynthesis converts the glucose that is made by cellular respiration to carbon dioxide

what is chloride shift ​

Answers

The chloride shift is an exchange of ions that takes place in our red blood cells in order to ensure that no build up of electric change takes place during gas exchange.

Which famous scientist developed a theory over 350 years ago that helps to explain the characteristics of gravity?


Edison


DaVinci


Bell


Newton

Answers

Answer:

Try Newton as your scientist

Select all of the following that correctly describe the Streptococcus genus
- Gram Negative
- Gram Positive
- Cocci
- Bacilli
- Tetrads
- Sarcinae
- Strepto
- Staphylo
- Fastidious
- Can grow in salt
- Can grow in acid
- Normal flora of the skin

Please explain if possible!

Answers

Gram Positive :

Streptococcus is a genus of spheroidal bacteria that belongs to the Streptococcaceae family.

The bacteria's distinctive clustering in chains that resemble a string of beads is referred to as streptococcus ("twisted berry"). Microbiologically, streptococci are classified as gram-positive and nonmotile. Cocci :

Streptococcus is a genus of gram-positive coccus (plural cocci) or spherical bacteria belonging to the Streptococcaceae family, which is part of the Lactobacillales (lactic acid bacteria) order in the Firmicutes phylum.

Gram-positive cocci are a diverse collection of bacteria that have a similar shape. Sarcina cells, for example, are grouped in cubical pockets. Streptococcus spp. resemble a string of pearls. Staphylococcus species do not divide on a regular plane.Bacilli :

Streptococcus bacteria subdivide into Strep. pyogenes (Group A), Strep. agalactiae (Group B), enterococci (Group D), Strep viridans, and Strep pneumonia. Gram-positive bacilli (rods) subdivide according to their ability to produce spores.

If complete hemolysis of the blood cells is observed, the streptococci are classified as beta'hemolytic. M protein is considered the most important virulence component of S. pyogenes. Antibodies that react with M protein are produced in response to infection. A prospective antistreptococcus vaccination based on the M protein or a derivative of it is being studied.Tetrads :

The tetrad occurs in a subgroup of the cocci where the bacterium divides in two planes to form a square of four bacteria called a tetrad. Some examples of tetrad-forming bacteria are the lactic acid bacilli, Aerococcus, a urinary tract pathogen and Pediococcus and Tetragenococcus, both of which ferment foods.

Tetrads are groups of four cocci that are positioned in the same plane (e.g. Micrococcus sp.). Sarcina is a bacterial genus that consists of eight cocci arranged in a cuboidal pattern (e.g. Sarcina ventriculi).Sarcinae :

Sarcina is a Gram-positive cocci bacterium genus belonging to the Clostridiaceae family. After the cuboidal (2x2x2) cellular affiliations they create during division along three planes, the genus gets its name from the Latin word "sarcina," which means "pack or bundle."

Diplococci are pairs of cocci; streptococci are rows or chains of such cells; staphylococci are grapelike clusters of cells; sarcinae are packets of eight or more cells; and tetrads are groups of four cells in a square layout. Variations in the reproductive mechanism of bacteria result in these distinctive groups.Strepto :

a combining term that means "twisted" and is used to make composite words: streptococcus

Streptococcus- a spherical or oval bacteria of the genus Streptococcus that occurs in pairs or chains and is harmful for humans, causing scarlet fever, tonsillitis, and other diseases.Fastidious :

Streptococcus is a genus of gram-positive cocci that are organized in chains. These are fastidious bacteria that need blood or serum added to their culture medium. They are non-motile and do not produce spores. Most are facultative anaerobes, which means they can grow on enriched media.

Streptococcus pyogenes - it's a nutrient-concious bacteria that ferments glucose to make lactic acid and has stringent growth needs. This section explains the growth and maintenance of S. pyogenes to help in the research of this organism.Can Grow In Salt :

On the basis of their salt tolerance, the salt tolerance test is used to identify enterococcal group D Streptococcus. Several bacteria, notably viridians streptococci, have been classified based on their capacity to thrive in the presence of a varying quantity of sodium chloride (NaCl).

The non-beta hemolytic streptococci (viridans, and non-enterococcal group D) do not grow in 6.5% NaCl broth; but some of the beta-hemolytic strains may grow in the broth.Can Grow In Acid :

Some streptococci can create acids, grow in acidic surroundings (acidophilia), make acids at low pH levels (aciduric capability), and synthesis intracellular and external polysaccharides.

Dental caries is associated mainly with acid production at pH values below 5 by nongrowing bacteria in dental plaque. Oral streptococci cannot grow at pH above about 5, although they can lower the pH of suspensions or biofilms to values of 4 or lower.Normal Flora of The Skin:

Bacteria make up the vast bulk of typical flora. Skin and nasal membranes are typically infected with Staphylococcus epidermidis.

Staphylococcus epidermidis is a Gram-positive bacterium that belongs to the Staphylococcus genus, which has around 40 species. It is found in marine sponges and is part of the normal human flora, most usually the skin flora and less commonly the mucosal flora.

Sources: ( https://www.cdc.gov/ )

how does cytokinesis happen in prokaryotes

Answers

Like...Rate...my answers

Follow me for

Like eukaryotes, cytokinesis is the last stage of separation for prokaryotes in a process called binary fission. ... During binary fission, a prokaryote begins by replicating its nucleiod (DNA) in the cell. Once this happens, the two nucleiods travel to the ends of the cell where there is cytokinesis

Like eukaryotes, cytokinesis is the last stage of separation for prokaryotes in a process called binary fission. ... During binary fission, a prokaryote begins by replicating its nucleiod (DNA) in the cell. Once this happens, the two nucleiods travel to the ends of the cell where there is cytokinesis.

write any two adaptational characteristics of the plants found in mountain region​

Answers

Answer:

Branches are sloping.

Trees have a cone shape.

The leaves have a needle shape.

The accumulation of snow is prevented by special structures.

Thick bark on trees.Explanation:

Where does meiosis occur in male and female?

Answers

Testes in males and ovaries in females
Regarding the human reproduction process, the meiosis occurs in the seminiferous tubules of the testes of the males, whereas the process takes place in oogonia cells of the females. In males, the meiosis significantly takes place at puberty, whereas in females, it takes place at the time of birth.

How can i earn money from this app?

Answers

Answer:

u dont earn money from brainly. the point is altruistic help

Explanation:

if u mean something else, provide context and ill leave a comment with the correct answer

can someone please help me on this all u have to do is search up on the internet and then write 4 facts that are mentioned in the web site  and give the main idea to but make sure I know were the main idea is

please help Im begging you and if u cant help then please dont Answer
this is the web site (5 reasons to bring back extinct animals)​

Answers

Answer:: De-termination could offer experiences into development and normal assets that are at present inaccessible to us.

2: Compromised or harmed biological systems could be reestablished with the assistance of specific now-wiped out species.

3 In the event that  people  drove plant and creatures species into termination, maybe we owe it to these species to attempt to bring them back.

4 De-elimination could be a major advance forward for hereditary designing.

There are loads of valid justifications to bring back wiped out creatures. All creatures perform significant jobs in the environments they live in, so when lost species are returned, so too are the 'positions' they once performed. Wooly mammoths, for instance, were nursery workers. ... It very well may be something similar for other de-wiped out creatures, as well.

Zeroing in on de-elimination could think twice about by redirecting assets from protecting environments and forestalling more current eradications. It could likewise diminish the ethical load of annihilation and backing for imperiled species, sending the mixed signal that resuscitating a wiped out creature or plant is trifling

im not sure if im right or if this is even close but i hope this helps of it doesn't i am so sorry

Explanation

Mandela's cancer began in skin cells and then spread to cells in the liver and brain. What type of cancer does this situation describe

Answers

metastatic melanoma ( if i’m not wrong )
cancer that begins in the skin cells, which spreads to other parts of the body ( in this case liver and brain)

Metastatic melanoma skin cells and then spread to cells in the liver and brain.

Metastatic melanoma is a disease that occurs when the cancerous cells from the original tumor.

Where does melanoma usually spread to first?

The first place a melanoma tumor metastasizes to is the lymph nodes, by literally draining melanoma cells into the lymphatic fluid, which carries the melanoma cells through the lymphatic channels to the nearest lymph node basin.

Thus, Metastatic melanoma is the answer.

To learn more about  Metastatic melanoma click here:

https://brainly.com/question/16989624

Other Questions
Amazon fresh is a grocery delivery service that offers customers the option of purchasing. 1. Nimish bought a motorcycle for 37,690 and sold it for 39,100. Find hisprofit or loss. why do we become a teacher? Find the new amount given the original amount and the percent of change.$7; 10% increaseThe new amount is When cells go through division in the early stages of life, they are known of stem cells. How dowe end up with all the different types of cells? Evaluate the expression: (2)2 + (42) + (18 23). which city has never had an nfl or pre-nfl franchise 2a- 1-4 1/3a+ 7-a consider the linear expression what are the like terms in the expression simplify the linear expression Annie comes to a sudden stop to avoid hitting a deer crossing the road at night. As she hits the breaks, her speed drops from 12 m/s to zero in 1.5 seconds.(p1) How far did she travel during that time? (p2)What was her average acceleration?Distance(p1)9 m8 m10 m13.5 mAcceleration(p2)6 m/s28 m/s212 m/s216 m/s2 Your father bought you a pair of shoes. When you wore the shoes you realized there was a problem. The shoes were too long. Why might such prblm arise and how can it be mitigated? Please answer it soon as possible The wavelength of yellow light in a spectrum is about 0.00002 inches. Which number best approximates this length as a power of 10? O A. 2x 10-5 O B. 2 x 105 O C. -2x 105 O D. 2 x 10-4 SUBMIT help me please fast Which law requires colleges and universities receiving federal funding to disclose information about crime on and around their campus crees que el estado nacin mexicano pudo haberse conformado de una manera distinta de tal manera que en la actualidad perteneciramos a los pases de primer mundo si o no, por qu?. which chemical is used in alcohol.which chemical is used in alcohol A container that can't expand, may explode from the ________ in pressure. the components of every food chain are Heredity refers to the __________.A.removal of DNA from the human bodyB.formation of chromosomes from DNAC.many types of female genesD.passing of traits from parents to children What is the lowest frequency photon that can ionize a hydrogen atom with excited state electron configuration 3s^1? Can someone plz help me? :( Which graph shows a dilation?