In biological systems, chemical energy can be stored in glucose or
released and made available for use. Which of the following
statements correctly describes how this energy is stored and then
released for use?
A.
Energy is stored in organic compounds during the process of cellular
respiration and then released during the process of photosynthesis.
B.
Energy is stored in organic compounds during the process of
photosynthesis and then released during the process of cellular
respiration.
C.
Photosynthesis and cellular respiration are both responsible for
storing energy in organic compounds and fermentation is responsible
for releasing that energy.
D.
Fermentation is responsible for storing energy in organic compounds
while both photosynthesis and cellular respiration are responsible for
releasing that energy.

Answer:

The anwser is A! i am taking a test with the exact question!!! please mark brainliest

A

Energy is stored in organic compounds during the process of cellular respiration and then released during the process of photosynthesis. Thus, Option A is correct.

It is a process by which autotrophic plant and bacteria use light energy as a source to make sugar from water and carbon dioxide.

They convert light energy into chemical energy which is stored in the form of starch.

The surface of  Leaves have chloroplast which absorb light energy.

[tex]\rm 6\;CO_2\;+\;6\;H_2O\;\rightarrow\;C_6H_{12}O_6\;+\;6\;O_2\\\\[/tex]

Th factors affecting photosynthesis are the intensity of light energy increased then rate of photosynthesis also enhanced.

Higher concentration of carbon dioxide induces the rate of photosynthesis. The average range CO2 needed is from 300 – 400 PPM

The adequate temperature needed between 25° to 35° C and water is an important factor, the scarcity leads to refusal of stomatal opening to retain the amount of water.

Thus, Option A is correct.

Learn more about photosynthesis, here:

https://brainly.com/question/26494694

#SPJ6

What is the name of the phase
in which a cell grows?

What are living bone cells called

In order to produce a tsunami, an earthquake must?

g Identify the statements that accurately describe how hydrogen ion concentration relates to energy production in oxidative phosphorylation. Hydrogen ion concentration is lower in the mitochondrial matrix than in the intermembrane space. The pH in the mitochondrial matrix is lower than the pH in the intermembrane space. Energy is generated as a result of the difference in hydrogen ion concentration between the intermembrane space and the cytoplasm. Oxidative phosphorylation relies on the hydrogen ion concentration gradient generated and maintained by the electron transport chain. Hydrogen ions enter the mitochondrial matrix via facilitated diffusion.

Men who are “benevolent sexist” have positive feelings about women as a group but,

Which cells can form ATP by breaking down glucose?

a
Animals only
b
Prokaryotes only
c
All cells
d
Plants only

Given the sequence ATGGCGAATCACGTCACTTGA
a) Write the sequence of nucleotides for the complementary strand of DNA.
b) Write the mRNA sequence transcribed from the complementary strand.
c) What is the tRNA sequence that would be used to translate this sequence?
d) Convert the message into an amino acid sequence.

temperature of water in morning

a
1. If a cell has no nucleus, the organism is a
a. Eukaryote
b. Animal
C. Plant
d. Prokaryote​

What energy molecule results from cellular respiration?

During the process of replication, a molecule of DNA unzips, forming two single strands what makes up each individual strand of DNA?
A( paired adenine and uracil bases
B( Paired thymine and guanine bases
C( sugar groups attached to individual amino acids
D( nitrogenous bases attached to a sugar- phosphate backbone

if the values for both mass and volume double, the value of the density will be?

PLEASE HELP

List the standard units of measurement for length, mass, volume, temperature, and time.

can anyone please tell why the bell jar is covered with black cloth in test for carbon dioxide ?​

Potatoes are native to Monuntainous areas of Bolivia and Peru in South America, but are now grown widely around the world. What kinds or environmental conditions do you think areas must have in common for a crop to be successful around the world?

I am a protein packaging and shipping machine! Who am I?

Could someone help me plz!

This is confusing for me so, first answer gets brainly Est PLEASEEEE
"Can dogs identify colors?" is an example of a scientific question. "Are dogs better pets than cats?" is not. Use complete sentences to explain the difference between these questions and why only one is scientific.

HELP PLEASE !!!
Fahrenheit and centigrade temperatures are related by the formula C = 5(F - 32) / 9 , where and F represent the temperatures in °C and ° F respectively . If the directions for a chemical experiment require that the temperature of a certain liquid be kept between 25 ° C and 30° C , what range of temperatures in ° F will satisfy the temperature restrictions of the liquid ?

Glucose is an organic compound produced during the process of photosynthesis. Select the word below that best describes glucose.

B. Nucleotide
A. Polypeptide
C. Monosaccharide
D. Steroid

Which are examples of harmful mutations? Check all that apply. one that causes a person to have a light patch of hair color one that changes a mouse’s eye shape but not its eyesight one that allows a moth to blend into its environment one that reduces a bean plant’s ability to make food one that increases the plants susceptibility to diseas

Karissa is conducting an experiment on the amount of salt that dissolves in water at different temperatures. She repeats her tests several times using the same procedure.
What can Karissa do to further increase confidence in the results of her experiment?

1.have another scientist run the same exact procedure in her lab

2.include several other liquids for comparison

3.calculate the average amount of salt that dissolves to summarize findings

4.make sure the experiment follows a specific procedure that allows other scientists to produce the same findings

5. Which of the following organelles would form a membrane-bound package, also known as a vesicle?
Group of answer choices

ribosomes

chloroplasts

Golgi apparatus

lysosomes

mitochondria

Question 6
Proteins within the extracellular matrix play a role in communicating between the matrix and the cytoskeleton.
Group of answer choices

True

False

Question 7
What function does the nucleolus have?
Group of answer choices

synthesizes ribosomal RNA

prepares products for export from the cell

contains the majority of cellular DNA

houses the chromatin

contains enzymes for intracellular digestion

Question 8
Which of the following is a function of glycoproteins?
Group of answer choices

to bind cells together into a functional organ

to permit cells to recognize one another

to allow cell-to-cell communication

to allow information to pass between adjacent cells

to stitch cells together so that they do not move apart

Question 9
Identify the organelle - function pairing that is mismatched.
Group of answer choices

lysosomes - contain digestive enzymes that can digest molecules or cellular components

plasma membrane - outermost barrier of a plant cell

ribosomes - capable of producing proteins for the cell

flagella - long, tail-like structure used in motility of some cells

nucleus - houses the DNA used for controlling all cell function

Question 10
Which of the following is a function of the nucleus?
Group of answer choices

prepares molecules for export from the cell

acts as the control center of the cell

manufactures molecules

assists in moving materials from one part of the cell to another

provides a place for produced cellular materials to be refined

People began to live together in locations that favored trade.
By 3000 b.C., several villages had developed into cities in
Sumer, a region in southern Mesopotamia
True
False

The particles that make up a solid move ? than do the particles that make up a gas.
A. In the same way
B. More quickly
C. More quickly and farther D. More slowly

are there instruments made of wood or metal​

What are the importance of family resources?

Did you notice a difference in the protists when the slowing agent was used? Which members were you able to see more clearly? Were there species that were still moving too fast to see clearly? Could you identify any species specifically? Do any of them look similar to specimens you observed in the first lab?

Allen Dexter, a 19-year-old college student, was rock climbing when he fell 30 feet to the ground. Paramedics arriving at the scene found him lying in the supine position, unable to move any extremities and complaining of neck pain. He was alert and oriented to his current location and the details of his fall. He complained that he could not feel his arms and legs. His pupils were equal and reactive to light. His vital signs revealed a blood pressure of 110 / 72 and a heart rate of 82 beats per minute. Breathing was steady but shallow. The paramedics immobilized his neck and transported him to the trauma center. Upon examination Allen had some sensation in his arms, but could not localize touch or describe texture. He was able to raise his shoulders and tighten his biceps brachii slightly in each arm, but could not raise either arm against gravity. His lower extremities were flaccid, despite attempts to move them. Vital signs were taken again at the hospital and were as follows: blood pressure=94 / 55; heart rate=64; respiratory rate=24 (with shallow breathing). His oral temperature was 102.2 degrees F. His color was dusky and his skin was warm and dry to the touch.

X-rays taken upon arrival revealed a fractured vertebra at the C5 level. A chest X-ray showed a decreased lung expansion upon inhalation. Blood tests were normal, with the exception of a respiratory acidosis (blood pH = 7.25). The neurosurgeons immobilized his neck by inserting tongs into the skull above the ears to hold his neck in a position so that no further injury could occur. Allen was transferred to intensive care and his condition was stabilized.

A physical examination four days later revealed normal vital signs and no change in his arm strength or sensation, but also marked spasms and exaggerated stretch reflexes of the lower extremities. He also had urinary incontinence which required the placement of a Foley catheter connected to a urine collection bag.

Required:
a. Why did the paramedics apply a cervical collar, place him on a back board and immobilize his head?
b. How would the paramedics test Allen's pupils reaction to light and what would the anticipated normal response be when exposed to light?
c. List his vitals on the scene of the accident and compare them to his vitals at the hospital when he arrived and four days post surgery.
d. What did the x-rays reveal?
e. What did blood tests reveal?
f. Describe the surgical procedure that was performed?
g. What were the physical findings four days post op?

Which type of molecule forms the cell membrane?
O phospholipid
O nucleic acid
O protein
O carbohydrate