Match the characteristics below to either gymnosperms or angiosperms.


____________nonflowering


_____________exposed seeds


____________garden flowers and tomatoes


______________seeds enclosed in fruit


______________pine or fir trees


______________flowering


*Choose from either Gymnosperms or Angiosperms*

Match The Characteristics Below To Either Gymnosperms Or Angiosperms. ____________nonflowering _____________exposed

Answers

Answer 1

Answer:

Gymnosperms:-

non-flowering, exposed seeds, pine, or fir fruit.

Angiosperms:-

flowering, seeds enclosed in fruit, garden flowers, and tomatoes

Explanation:

Gymnosperm

Nonflowering and exposed seed

Gymnosperms are the group of plants that do not possess or produce the egg in the enclosed seed which makes there seed naked or exposed

Pine or fir trees

Fir and pine are trees, and more specifically conifers, which belong to the family Pinaceae. of the gymnosperm

Angiosperms

Garden flowers and tomatoes

Tomato plants and garden flowers are the plants that belong to flowering plants or angiosperms.

Seeds enclosed in fruit

In angiosperms, there is a closed ovary that enclosed the egg to protect it. After fertilization ovary turns into a fruit.

Flowering

Angiosperms are the plants that also known as the flowering plant that means these plants are able to produce flowers that are sexual organs of the plant and help in reproduction.


Related Questions

3. Your family is planning a picnic for the weekend. Would you want predictions of weather
or climate? Explain your answer.

Answers

Yes because if the weather was rainy or the climate was humid or foggy, it wouldn’t be a delightful trip.

Below are models of two types of cells. Which of the following structures are common to both cell types?

A. mitochondria and vacuoles
B. mitochondria and cell wall
C. vacuoles and chloroplasts
D. cell wall and chloroplasts

Answers

Answer:

A.mitochondria and vacuoles

Explanation:

The one on the left is the animal cell and the one on the right is the plant cell.

Both of these contain mitochondria and vacuoles(are larger in plant cells).

URGENT!
__________ fabric wrinkles less than ____________ fabric.
Linen, synthetic
Jute, Synthetic
Cotton, synthetic
Synthetic, cotton

Answers

Answer:

Synthetic, cotton

Explanation:

Synthetic fabric wrinkles less than cotton fabric.

Wrinkle is known to be an unusual fold, ridge or crease in the cloth. Some cloth experience this type of wrinkle why some do not. The material of the cloth determines its ability to wrinkle.  Synthetics are known to be more wrinkle resistant than cotton and even linens. 100% linen or a blend of cotton/linen. Even polyester clothes are more wrinkle resistant than cotton.

Select the best answers from the drop-down menus.
regulate organ function.
control voluntary muscle movements.
control involuntary muscle movements.

Answers

Answer:

voluntary muscle movements

Answer: general visceral nerves

Somatic nerves

Special visceral nerves

Explanation:

An plant only requires the correct chemicals to make plant food

Answers

False plant do not require chemicals to make plant food

PLEASE HURRY,(GIVING BRAINLIEST) (THE ACTUAL SUBJECT IS SCIENCE)After a major forest fire kills all of the plants in an area, the first plants to grow in the burned area are often types of grass. Because they are the first thing to grow in the new ecosystem, these types of grass are called pioneer species. What adaptations would help the grass be a successful pioneer species?

A.

slow reproduction and the ability to grow in sunny places

B.

rapid reproduction and the ability to grow in sunny places

C.

slow reproduction and the ability to grow in shady places

D.

rapid reproduction and the ability to grow in shady places

Answers

Answer: B

Explanation:

To help the pioneer species to grow, it needs to have rapid reproduction. But, it also needs the sun to grow very well. If it does not have the Sun, it will most certainly die and be endangered in the area. The answer is B, we need both rapid reproduction and the Sun.

Answer:

rapid reproduction and the ability to grow in sunny places

Explanation:

After a major fire, less sunlight is blocked by trees and other plants. Plants that can use the increased sunlight are more likely to thrive in the new environment. Rapid reproduction would help a plant species to spread more quickly to take advantage of the resources and lack of competition. Therefore, the adaptations that would help grass be a successful pioneer species are rapid reproduction and the ability to grow in sunny places.

LOTS OF POINTS!?!?!The amount of CO2 coming out of volcanoes is less than Type Here% of what goes into the atmosphere from burning fossil fuels.
FILL IN THE TYPE HERE PART!?!?!?!

Answers

It would be 60 times

a hypothesis for exercise 2 might state "if the five substances are distinct, then they will have unique characteristics that distinguish them from one another." Was this hypothesis supported or disproved?

Answers

Supported i’m pretty sure. Not much background to the problem though.

How do plate tectonics support evolution?

Answers

Plate tectonic processes such as the redistribution of continents, growth of mountain ranges, formation of land bridges, and opening and closing of oceans provide a continuous but moderate environmental pressure that stimulates populations to adapt and evolve.

Explain the interaction with another body system.

Answers

Answer:

Body systems are used throughout your body to help you move and to live like the heart for example.

Which of the following is not characteristic of a behavior?

Answers

Answer:

list

Explanation:

Answer:

exicted

Explanation:

how is the cell able to make the many different proteins it needs? In your answer, be sure to: identify where in the cell the information necessary to make a particular protein is located and the specific molecule that contains this information AND identify both the cellular structure that makes these proteins and the kinds of molecules that are used as the building blocks of the protein

Answers

Answer:

Explanation:

Most genes contain the information needed to make functional molecules called proteins. (A few genes produce other molecules that help the cell assemble proteins.) The journey from gene to protein is complex and tightly controlled within each cell.

Where does warm water accumulate in the Pacific Ocean during El Niño

Answers

Answer:

east

Explanation:

Study this image. PLEASEE HELPP WILL GIVE BRAINLYEST

Which statement correctly explains what is happening?


A. Oceanic and continental plates are colliding.

B. Oceanic and continental plates are shifting past each other.

C. Two continental plates are forming a large mountain.

D. Two oceanic plates are creating several island chains.

Answers

Answer:

its B

Explanation:

becuse When oceanic or continental plates slide past each other in opposite directions, or move in the same direction but at different speeds, a transform fault boundary is formed. No new crust is created or subducted, and no volcanoes form, but earthquakes occur along the fault.

Which statement did Virchow's work add to the cell theory?
A. Cells contain genetic material that consists of DNA.
O B. The cell is the basic structural and functional unit of life.
O C. All living things are made of one or more cells.
O D. All cells come from other living cells.

Answers

Answer:

D

Explanation:

The German doctor Rudolf Virchow proposed that all cells result from the division of previously existing cells, and this idea became a key piece of modern cell theory.

This results from cytokinesis when he observes cells splitting into two.

please give thanks by clicking the heart button! :)

D. All cells come from other living cells

What is the manipulated variable in this experiment?
O A. The distance the snails moved
OB. The size of the petri dishes
C. The temperature of the water
D. The number of snails observed HELP ME

Answers

The correct answer is C. The temperature of the water

Explanation:

In an experiment such as the one described about the speed of snails in water, the manipulated variable is the factor or element that is manipulated on purpose. This means the researcher or researchers slightly change this element to compare how this affects another variable. In this context, the manipulated variable is the temperature of the water because researchers used three different temperatures (cool, room-temperature, and warm), and therefore they manipulated or changed this factor. Moreover, it is expected temperature affects the distance nails move, which is the main variable.

HURRY I NEED HELP QUICKLY. As part of an adventure challenge, you find yourself dropped into a unknown place. There are birds and wolves. The air is cold, and the ground is very hard. What biome have you landed in? Explain.

Answers

Answer:

You have landed in a tundra.

Explanation:

Birds as in penguins

Wolves as in Arctic wolves/foxes

The ground is hard because it is frozen

The air is cold

what is Acetyl-coA and how does it help with food digestion ?

Answers

Answer: what is Acetyl CoA is made from pyruvate under aerobic conditions in the mitochondria. The process of conversion is irreversible. I don't know the other half I'm sorry.

Explanation:

Acetyl CoA Used by the citric acid cycle as a fuel. Carbon acetyl groups are converted to CO2 and ATP and electrons (carried by NADH and FADH2) create even MORE electrons.  Acetyl CoA is made from pyruvate under aerobic conditions in the mitochondria. The Process of conversion is irreversible.

Write a paragraph about the symbiotic association between algae and fungi​

Answers

Answer:

if you need the answer then follow

Explanation:

me and I swear I will send the answer after you follow me

Energy conversion in which sunlight, water and carbon dioxide is converted into oxygen
and glucose.

Answers

Answer:

Photosynthesis

Explanation:

Drag each label to correct location on the image
When a honey bee stings

Answers

Answer:

see explanation

Explanation:

please l can't see the image ‍♂️

Q1.
The process of Transcription is involved in the ?
(a) Conversation of RNA & DNA
(6) Movement of RNA from nucleus
(c) Formation of RNA & DNA
(d) None of these​

Answers

Answer:

Transcription is DNA -> RNA

Explanation:

Transcription is DNA to RNA

Translation is RNA-> Proteins

Describe three roles of lipids

Answers

Answer:

-storing energy

-chemical messengers

-structure

Explanation:

-chemical messengers , structure & storing energy

Why do most of the marine species live at or near the surface of the ocean

Answers

Answer:

Most marine organisms live within the sunlit surface waters. Strong sunlight supports photosynthesis by marine algae. Algae either directly or indirectly provide food for the majority of organisms. ... Most marine animals also live near the surface because this is where they can find food.

Explanation:

Brainliest please?

(PLEASE HURRY)Strong winds blow sand to a new location, and some of the sand forms a sand dune. The first plant species to live in the new habitat of the sand dune is a type of grass. This grass stabilizes the sand dune. Over time, the sand dune grows larger and soil forms on the surface. As these changes occur, different plant species become dominant.

Why doesn't the original grass remain the dominant plant on the sand dune?
A.
The grass cannot reproduce fast enough to cover all of the growing dune.
B.
New plants are better suited to the new conditions in the sand dune habitat.
C.
The grass moves to new sand dunes to start the succession process again.
D.
New animals come to the new sand dune habitat and eat the grass.

Answers

C because the grass needs ro sand dunes

What substances are combined with sunlight in the process of photosynthesis?
A. carbon dioxide and water
B. water and simple sugar
C. carbon dioxide and oxygen
D. oxygen and simple sugar

Answers

Answer:

D is the answer

Explanation:

check it out

(4pts) Drugs, medicines, and poisons often work by acting on endogenous proteins. They do this by looking similar to a signal molecule and binding to the endogenous protein. Look up these four examples to fill in this chart. Drug, medicine, or poison Looks similar to this endogenous molecule: Binds to this endogenous protein/receptor: Muscarine Acetylcholine muscarinic receptors Prozac Serotonin serotonin transporter protein Ketamine NMDA NMDA receptor Tamoxifen estrogen estrogen receptor

Answers

Answer:

Drug, medicine, or poison: Muscarine; Looks similar to this endogenous molecule: Acetylcholine; Binds to this endogenous protein/receptor: muscarinic receptors

Drug, medicine, or poison: Tamoxifen; Looks similar to this endogenous molecule: estrogen; Binds to this endogenous protein/receptor: estrogen receptor

Drug, medicine, or poison: Prozac; Looks similar to this endogenous molecule: Serotonin; Binds to this endogenous protein/receptor: serotonin transporter protein

Drug, medicine, or poison: Ketamine; Looks similar to this endogenous molecule: NMDA; Binds to this endogenous protein/receptor: NMDA receptor

Explanation:

Muscarine is a poisonous natural product found in certain mushrooms. It is similar to acetylcholine and competes with acetylcholine at its receptor binding sites.Signs of muscarine poisoning include salivation, lacrimation, vomiting, diarrhea, abdominal pain, bradycardia, etc.

Tamoxifen is a selective estrogen receptor modulator. It is similar to estrogen and acts by inhibiting the effects of estrogen in the breast tissue. It is used to prevent and treat breast cancer in men and women.

Prozac is an antidepressant which belongs to th class known as selective serotonin reuptake inhibitors. It looks similar to serotonin and inhibits its action by competing with serotonin for its binding site. It is used for the treatment of depression disorders.

Ketamine is an NMDA (N-Methyl-D-aspartate) receptor antagonist. NMDA receptor antagonists are a class of drugs that work by inhibiting the action of the NMDA receptor. They are commonly used as anesthetics for animals and humans to induce a state of anesthesia known as dissociative anesthesia.

Please help. What safeguards are in place to protect Americans from unsafe food? Are these methods science-based?

Answers

Answer: The FDA and USDA cerate food safety programs, safeguards to protect Americans, to protect people from unsafe food. The FDA has monitoring programs for pathogens, naturaltoxins, pesticides, etc.; their methods are science-based.

The safeguards that are placed to protect Americans from unsafe food are FDA and USDA. FDA means food and drug administrator and USDA means U.S. department of agriculture.

What are FDA and USDA?

FDA stands for food and drug administrator. It is a health and food department to ensure public health and to check the food items that the citizens are consuming.

USDA stands for The United States Department of Agriculture. The department is responsible for making the laws regarding food quality, and they also develop new qualities of fruits and vegetables.

These departments are based on scientific research and methods. Many scientists work under this to save people from having bad food.

Thus, The FDA and USDA are the safeguards set up to protect Americans from tainted food.

To learn more about FDA and USDA, refer to the below link:

https://brainly.com/question/21469257

#SPJ2

Activity #1
Normal DNA Sequence
DNA:
TACCCCGTGCAT ATAT CATATAGCACT
mRNA:
Protein:
Mutated DNA Sequence
DNA:
TACCCCGTGCACATATCGTATAGCACT
mRNA:
Protein:
Describe the effects of the change(s) in the mutated DNA sequence. Did the protein change? Do you think
this protein can perform its normal function?
Stephanie Elkowitz
Help please!!!!

Answers

for the normal DNA sequence, since thymine (T) binds with adenine(A) and Adenine(A) binds with uracil(U) because there is no thymine is RNA guanine(G) pairs with cytosine(C) :

normal DNA:TACCCCGTGCAT ATAT CATATAGCACT

normal mRNA:AUG GGG CAC GUA UAU AGU- AUA UCG UGA

i grouped letters in threes as codons

normal Protein:methionine-glycine-histidine-valine-Tyrosine-Serine-Isoleucine-serine-stop

 mutated DNA:TACCCCGTGCACATATCGTATAGCACT

mutated mRNA:AUG GGG CAC GUG UAU AGC AUA UCG UGA

mutated protein:methionine-glycine-histidine-leucine-Tyrosine-Serine-Isoleucine-Serine-stop

In the mutated protein valine is replaced with leucine. Those two amino acids have different radicals that perform different functions so the protein will have an altered function.

An experiment is designed to compare the effects of glucose and sucrose on the osmoticpotential of a model cell. Two dialysis bags are used, one filled with a solution of 5% by massglucose and the other with a 5% by mass sucrose solution. A given membrane is permeable towater but impermeable to glucose and sucrose. Each membrane bag is then placed in a beaker ofdistilled water for two hours. The change in mass of the glucose bag is recorded below.Solution (5% by mass) Initial Mass ofSolution andMembrane Bag (g) Final Mass of Solutionand Membrane Bag(g)Glucose in DistilledWater 10.0 13.2Sucrose in DistilledWater 10.0 ?I got this question incorrect because I said the glucose would pass through the semipermeablemembrane, however, it would be the water that passes through. One way I can prevent myself.

Answers

Answer:

i dont understand you're qiestion

Glucose can pass through the semi permeable membranes where the molecules can pass because they are soluble in water enough. The  molecules can pass through because of the solubility factors.

What is a semi permeable membrane ?

It is the semi permeable membrane where the half of the molecules get passed through the membrane. The molecules are selectively present.

Cell membranes are an example of semi-permeable membranes. Cell membranes allow small molecules such as oxygen, water carbon dioxide and glucose to pass through, but do not allow larger molecules like sucrose, proteins and starch to enter the cell directly.

Transport is helped by certain molecules as well where the few of the ions, channels and the molecules are taken up by the membrane through the selected transportation of the ions.

Learn more about selectively permeable membrane at :

https://brainly.com/question/11635962

#SPJ5

Other Questions
Why did Marxist ideology emerged during the industrial revolution? Find the 12th term of the geometric sequence 4,8,16? paragraph. how to choose a true friend Adams tells Jefferson HELP NOW PLS !! If you exert 950 N*s of impulse on a 12 kg frictionless cart over the course of 5 seconds, how far will it travel during those seconds? What is the quotient of 3 /7 + 4/8 using reciprocal express your answer in lowest term Which person would be most threatened by silver carp in a local water source?A waterskier B A chicken farmer C A bungee jumper D A beachgoer Activity #1Normal DNA SequenceDNA:TACCCCGTGCAT ATAT CATATAGCACTmRNA:Protein:Mutated DNA SequenceDNA:TACCCCGTGCACATATCGTATAGCACTmRNA:Protein:Describe the effects of the change(s) in the mutated DNA sequence. Did the protein change? Do you thinkthis protein can perform its normal function?Stephanie ElkowitzHelp please!!!! Please answer this, I really need help!!! Devon is trying to find the unit price on a 6-pack of drinks on sale for $2.99. His sister says that at that price, each drink would cost just over $2.00. Is she correct, and how do you know? If she is not, how would Devons sister find the correct unit price? daniel le presto los videojuegos a andres Explain the interaction with another body system. In Feudalism, what did vassals receive in return for their loyalty to the king? whats the answer....................... true or falseThe United States share of worldwide direct investment is more than 80% The adjusted trial balance of Indigo Corporation at December 31, 2017, includes the following accounts: Retained Earnings $16,651, Dividends $6,759, Service Revenue $35,644, Salaries and Wages Expense $13,785, Insurance Expense $1,799, Rent Expense $3,872, Supplies Expense $1,413, and Depreciation Expense $804.Prepare an income statement for the year. Explain the three types of erosion listed: Splash erosion, sheet erosion, rill erosion A term without a variable is called what? Jill does twice as much work as Jack does and in half the time. Jill's power output is Group of answer choices one-fourth as much as Jack's power output. four times Jack's power output. twice Jack's power output. one-half as much as Jack's power output. the same as Jack's power output. answer please !!!!!!!!!!! Will mark Brianliest !!!!!!!!!!!!