⚠️MATH QUESTION⚠️ Angle Similarity

MATH QUESTION Angle Similarity

Answers

Answer 1

Answer:

5 in.

Step-by-step explanation:

If you can see, Triangle ABE has the side with 10 in. and 25 in. on the other side and Triangle FCD has one side with 15 inches, so the bottom one should be 5 in. because decreasing size.

Answer 2
I’m not very sure but I’m pretty sure it’s 5

Related Questions

What will happen? (Newton's 1st Law Egg Drop)

Answers

Answer  

the water would pervent it from cracking

Step-by-step explanation:

What is 2x + 8 & 4x - 4 ?
Don't use a bot have actual proof please.

Answers

Answer:

ok well I give you different ones and you can take whichever one goes with what you're doing.

Step-by-step explanation:

what is 2(3p – t) – (–4p + t)?

Answers

What the other person said

Answer:

That would be 10p - 3t.

Have a good Wednesday!

WILL GIVE BRAINLIEST



Which of the following has a slope of 3 and y-intercept of 4. Select all that apply

y=4x+3y is equal to 4 x plus 3



y = 3x + 4
y = 3x + 4

y = -3x - 4
y = -3x - 4

Answers

Y=3x+4 the number in the middle with the x is always the slope and the number in the end is always the y intercept to graph it you wanna find (0,4) on the graph. 3x = 3/1 on the graph from the y intercept you wanna go up 3 which would be (0,7) and go right one which would be (1,7) so the answer is (0,4) (1,7)
y=mx + b
m= slope
b = y-intercept
y=3x + 4

Nadia's grades on four quizzes were 95, 75, 85, and 95. Find the mean, median, and mode for Nadia's grades. ​

Answers

Answer:

mean: 87.5

median: 80

mode: 95

What is mean? : the sum of a collection of numbers divided by the number of numbers in the collection so for this is:

95+75+85+95= 350 divided by 4 because there's 4 numbers = 87.5 which is the mean

What is median?: The median is the value separating the higher half of a data sample so for this think of crossing each number at the opposite sides: 95 and 95 cancel now your left with 75 an 85 add them up and divide by 2 because there's 2 numbers **for median you are either left with 1 number or 2 if the case is 2 you ADD first then divide by 2 ALWAYS**: 75+85= 160/2= 80 for median

What is mode?: The mode is the value that appears most often in a set of data. So as we know 95 repeats the most

First u want to order the numbers from greatest to least 95,95,85,75
Mean: all numbers added up then divided by the number of numbers u have. So 95+95+85+75= 350 divided by 4 = 87.5
Mean=87.5
Median: the middle number. So after the numbers r ordered from greatest to least take one number off each side until u get to the middle. In this case there are two middle number 95 and 85 so u add them then divide by 2 95+85= 180 divided by 2= 90
Median= 90
Mode: the number that repeats most in the set of numbers. In this case the mode is 95 because there r 2 95s
Mode: 95

HURRY PLEASE

Solve the equation. 4x − 2 = 8x + 10 Use algebra tiles to assist you.

x = -3

x= 3

x = 8

x = -8

Answers

Answer:

x=-3

Step-by-step explanation:

4x-2 = 8x+10

4x-2 (-8x) =8x+10 (-8x)

-4x-2=10

-4x-2 (+2)=10 (+2)

-4x = 12

-4x (divded by -4) = 12 (divided by -4)

x = -3

hope it is correct! and hope i helped

The answer would be -3

does anyone know this?

Answers

Answer:

i think the answer is  c

Step-by-step explanation: if  wrong srry

Solve for zzz: -0.25z = -1.25−0.25z=−1.25minus, 0, point, 25, z, equals, minus, 1, point, 25 z =\,z=z, equals

Answers

i need an actual equation, no one is going to do any with that

Ya it is harder to read like that

please give correct answer ! :)

Answers

Answer: You go 5 units down from point A and 3 units to the left.

Answer:

go 5 units down from point a and 3 units to the left

explanation:

Lake City uses a cone-shaped building to store the salt they spread on their roads during winter. Each storage building has a radius of 39 feet and a height of 48 feet.

Using 3.14 for , approximately how much salt can each storage building hold?
A. 76,415.04 cubic feet

B. 229,245.12 cubic feet

C. 5,878.08 cubic feet

D. 94,049.28 cubic feet

Answers

Answer:

I believe that the answer is A. 76,415.04 cubic feet

Step-by-step explanation:

I used a formula I found online

Hope this helps

Kelly drew the angle shown,
which value is closest to measurement of Kelly's angle?

Answers

Answer:

70°

Step-by-step explanation:

it's an acute angle so it couldn't be 110 since that would make it obtuse.

70°

Answer choice C and D would make the angle obtuse, and answer choice A would make the angle into a smaller acute angle


I hope this helped! ~(^v^)~

In a wildlife preserve, a random sample of the population of 150 raccoons was caught and weighed. The results, given in pounds, were 17, 19, 19, 24, 25, 27, 30, 31, 31, and 32. Jean made the qualitative statement, "The average weight of the raccoon population is 26 pounds." Is her statement reasonable? Complete the explanation.

Jean's statement (is/is not) reasonable because the median value of the data is _________ pounds.

Answers

Answer:

Jeans statement is reasonable because the median value of the data is 26 pounds

Step-by-step explanation:

leven purple marbles, seven orange marbles and two pink marbles are in a bag. What is the probability of selecting a purple marble, not replacing it, and then selecting an orange marble?

Question 4 options:

19%


20%


21%


22%

Answers

Answer:

The probability of picking a purple marble, and then, not replacing picking an orange marble is approximately 20%

Step-by-step explanation:

First we know that there are 20 marbles in the bag, so the probability of picking a purple marble is 11/20. If we take a purple marble out, there will only be 19 marbles remaining in the bag. So the probability of picking an orange marble would be 7/19. Now, all we need to do is multiply the 2 fractions, and we will get 77/380 which equals to which is approximately 20% .

Answer
The answer is 20%

Please answer all the questions in the pictures attached today. If you steal my points, you will be reported ASAP!! Thank you! :)

Answers

Answer:

pic 1: C. uncommon cards

pic 2: 4 = 5, 8 = 10, 10 = 12.5

Step-by-step explanation:

pic 1: for every ultra rare is _ cards.

4 x 6

24 uncommon cards

pic 2: multiply 1.25 x 4 because that is the amount of burgers. you get 5

divide 10 by 1.25 to find the amount of burgers. you get 8.

multiply 1.25 x 10 - 12.5

Answer this question please and thank you

Answers

Answer:

10

Step-by-step explanation:

Since 1 1/4 x 9 = 11 we can't just jam the extra half a pound into the containers. Therefore, we need 10 containers to securely place the 11 1/2lbs of salad into the containers.

^yeah i got the same answer

Answer this question please and thank you

Answers

Answer:

1

1

0

0

Step-by-step explanation:

here´s and example for 1

1⁵

1x1x1x1x1=1

so 1 raised to the power of any number is 1

1 multiply by itself any number of times is 1

here´s an example for 0

0⁴

0x0x0x0=0

hence, the vale of 0 raised to any power is 0.

0 multiplied by itself any number of times is 0

Sam found the area of a polygon. The area is 36 in2. Which of these polygons has an area of 36 in2? Explain your reasoning.

Answers

Answer:

C

Step-by-step explanation:

Because:

4x3:2=6in2

4x3:2=6in2

3x8=24in2

24in2+6in2+6in2=36in2

Answer:

C is correct

Step-by-step explanation:

I did the math again the other person is correct

Find the distance between C and D
C:(4, -5) D:(-3, -5)

Answers

Answer:

The answer is 7 units

Step-by-step explanation:

I hope this helps!

(credit to person above)
7.
The difference between 4 and -3 is 7.
-3 + 3 = 0, 0 + 4 = 4.
3+4 (the numbers we added to -3 add up to 4.

I dont understand this loll

Answers

Answer
A.3
B.3
C.1/2/3

HURRY I need help Three corporations each own land. Corporation A owns 3.2 × 105 acres, corporation B owns 4 × 104 acres, and corporation C owns 4.3 × 105 acres. Which corporation owns the most land? How many times greater is corporation A’s land than corporation B’s land?
A.
Corporation A owns the most land. Corporation A owns 8 times more land than corporation B.
B.
Corporation B owns the most land. Corporation A owns 4 times more land than corporation B.
C.
Corporation C owns the most land. Corporation A owns 8 times more land than corporation B.
D.
Corporation C owns the most land. Corporation A owns 80 times more land than corporation B.
E.
Corporation A owns the most land. Corporation A owns 40 times more land than corporation B.

Answers

Answer:

Corporation A owns the most land. Corporation A owns 8 times more land than corporation B.

Simplify write without the absoulute value.

|x-(-12)|, if x<-12

Answers

Answer: Hello! The Answer is 0 without the absolute value! Your Welcome! Mark me as Brainliest! :)

Step-by-step explanation:

The answer is 0 .......

Between which two numbers is Negative 1.5 located on a number line?

A number line going from negative 5 to positive 3 in increments of 1.

QUICKKK

Answers

between -2&-1 is the answer

Answer: between -2 and -1

Step-by-step explanation:

You randomly choose one of the tiles. Without replacing the first tile, you randomly choose a second tile. Find the probability of the compound event. Write your answer as a fraction or percent rounded to the nearest tenth.

Answers

i think it's 1/2 or 1/4

pls answer quickly
Rewrite without absolute value for the given condition: y=|10-x|, if x <10

Answers

Answer:

y=|10-10|

Step-by-step explanation:

Answer:

Step-by-step explanation:

x<10

0<10-x

or 10-x>0

so y=10-x

Scott's gas tank is 1/3 full. After he buys 12 gallons of gas, it is 7/9 full. How many gallons can Scott's tank hold?

Answers

Answer: We start with the variable "x". Let's call "x" Dan's full tank.

So we know that right now he has 1/3x or 1/3 of a full tank.

After adding 12 gallons, at the end, he has 7/9x, or 7/9 of a full tank

So we start with

(1/3)x + 12 = 7/9x

Let's subtract 1/3x from both sides

12 = 7/9x - 1/3x

Remember, we need to use common denominators to subtract, so 1/3 becomes 3/9

12 = 7/9x - 3/9x

Now we simplify to get

12 = 4/9x

Multiply the reciprocal of 4/9 to both sides which is 9/4

12 * 9/4 = x

Answer is 27 gallons.

The lines s and t intersect at point R.
What is the value of y?

Enter your answer in the box.

y =

Lines t and s intersect at point R. Obtuse vertical angles measure seventy-nine plus y degrees and four y minus eight degrees.

Answers

Answer:

61

Step-by-step explanation:

79 + 40 = 119

180 - 119 = 61

Answer:

(4y-8)=(79+y)

3y=87

y=29

Step-by-step explanation:

PLEASE HELP! I CANT GET A BAD GRADE!

--------------------------------------------
Consider the data below.

2, 2, 2, 3, 5, 6, 8, 30

The mean decreases by ? when the outlier is removed.

Answers

Answer:

It is decreased by 3.25

Step-by-step explanation:

When you add all 8 numbers you'll get 58 then you divide them by 8 you will get 7.25 which is the mean. To find out what is the decrease we need to take out the 30 and add all the other numbers and we get 28. After that you divide 28 by 7 and you get 4. Subtract 4 from 7.25 and you get 3.25.

2+2+2+3+5+6+8+30=58

58/8=7.25

2+2+2+3+5+6+8=28

28/7 = 4

7.25-4=3.25

he owner of a produce stand is selling bunches of grapes, priced by the pound. She rounded each measurement to the nearest \dfrac{1}{8} 8 1 ​ start fraction, 1, divided by, 8, end fraction of a pound.

Answers

Yes I agree I don’t have a good night I have no idea what I am doing lol I just don’t have a problem I don’t

I really need help!! Which box doesn't belong??

Answers

Answer:

I think it's C

Step-by-step explanation:

A is go up one time

B is go down one time

C is... not sure what's going on there

And D is multiply by 8

I'm confused.

Emily has a cube with an edge of 8cm. If she wants to paint it, how many square centimeters will she paint?

Answers

Answer:

384 cm ^2

Step-by-step explanation:

Basically, we're finding the surface area.

The cube is 8*8 all around

Each box has an area of 64cm each.

There are 6 sides on a cube.

64*6 = 384

Hopefully this made since.

Other Questions
Radioactive decay occurs when the ____ decays Read the following sentence:Some kinds of water quality can be checked right in the stream or at the well.Which answer correctly uses domain-specific language to strengthen the writing? A)Some aspects of water quality can be determined directly in the stream or at the well.B)Some kinds of water quality can be figured out right in the stream or at the well.C)Some types of water quality can be tested right in the stream or at the well.D)Some aspects of water quality can be checked right in the stream or at the well. Please complete the following DNA strands1. AGGTCCAAGCTCAAATTTCCCC2. GAAACCCCTTAAACCTTAATTCC3. GCGCGCGCAAATTTTTCCCATCTPlease complete the following strands using RNA:1. AGGTCCCAAAGGCCCTTTCC2. UAAAGGGCCCAGCCCACC3. CUAAAAGGGGGUUUUAACC What is 1/12 cups converted into ounces? Match the countries and their aims after World War I.GermanyFranceItalyUnited Stateswanted to establish a lasting peace in Europewanted a treaty based on the armistice it had signedwanted territories near the Adriatic that Britain had earlier promisedwanted to punish and weaken Germany Plz, answer this question plz! Plz, answer this question plz! Plz, answer this question plz! Plz, answer this question plz! Plz, answer this question plz! I need help with these two questions Bob ate 1/3 loaf of bread over 4 days. He ate the same amount of bread each day. What fraction of the loaf did Bob eat each day? danielle did not complete 15 of her 200 assignments last year. Kim said that is 0.075 of her assignments and Kelly said it is 0.75 of her assignments. Who is correct and how do you know? A ___________ is a large volcano built up of alternating layers of lava and ash, or cinders.a.stratovolcanoc.cinder coneb.shieldd.stratus volcanoPlease select the best answer from the choices providedBRAINLYIST PROVIDED I NEED HELP GUYSDid the French Revolution achieve its goals? Why ? Or why not? the cost of lunch l after a 15% tip can be represented by the expression l + 0.15l. Simplify the expression. Then determine the total cost of the lunch after the lunch bill is $10. Please somebody answer fast I really need this answer Leading up to the signing of a contract with an integration clause, a buyer sent an e-mail to the seller of a beautiful, new $45,000 boat asking, "You provide financing, right?" The seller responded, "Yes, of course." The contract, which the parties signed yesterday, said nothing about financing. Right after signing, the seller said, "OK, let's get you set up with financing!" He then ran the buyer's credit, which was not good. The buyer was not approved for financing through the seller's only source. The buyer believes that he, therefore, is not liable for the cost of the boat. Is the buyer correct? Work out the length x.17 cm9 cm Here is an expression 3*2t. Evaluate the expression when t is 1 What is radioactive dating?A. A comparison of the energy emitted from nuclei based on ageB. The determination of how old a radioactive isotope isC. The use of radioisotopes to determine the age of somethingD. A process to determine the half-life of a radioactive isotope Plagiarism can be defined in all of the following ways EXCEPT:A. deliberate, unacknowledged use of someone else's language, ideas, or other original materialB. presenting false or fabricated data or sourcesC. submitting the same paper for more than one course without the instructor's permissionD paraphrasing what someone else said and using parenthetical citations to give credit A dolphin is swimming at a depth of 3.4 meters with respect to sea level when it begins diving deeper at a constant rate of 0.25 meter per second. In how many seconds will the dolphin reach a depth of 9.9 meters below sea level? one, no, or infinitely many solutions