Mike discovered that the pool in his backyard is leaking slowly. The pool holds 17,085 gallons of water, and is leaking at a rate of 20
gallons per day.
If Mike does not replace the water that has leaked from the pool, how many gallons of water will remain in the pool
after 103 days?

A. 15,025 gallons
B. 16,055 gallons
C. 17,188 gallons
D. 19,145 gallons

Answers

Answer 1
A cause if you add and multiple you get it

Related Questions

One year, the population of a city was 335,000. Several years later it was 314,900. Find the percent decrease.

Answers

1 got 900 step by step explanation is monkey explain

Mr. Moss had 2 gallons of paint. He painted 3 doors. How many benches can he paint with the paint that is​ left? Show your work.

Answers

Answer:

uh depends on how much paint he used for the doors and how much paint he needs for the benches

Step-by-step explanation:

How do I solve and show work?

Answers

Answer:

this is the answer⬆hope it helps

Evan jarred 10 liters of jam after 2 days. How many days does Evan need to spend making jam if he wants to jar 15 liters of jam in all? Assume the relationship is directly proportional.

Answers

Find liters per day by dividing the amount made by the number of days :

10 liters / 2 days = 5 liters per day.

Find how much more he needs to make by subtracting the amount made from the total he wants:

15 liters - 10 liters = 5 liters more needed.

Divide amount needed by time:

5/5 = 1

He will need to spend 1 more day, which means he will spend a total of 3 days to make 15 liters.

Which of the following is the solution to IX-131< 18?
Inequalities

Answers

Answer:

is there supposed to be a pic attached I need more info

Pls help me solve 10k - 90 =m -10 *

Answers

Answer:

M = 10k - 80 and k = m/10 + 80

Step-by-step explanation:

A trapezoid is broken into a triangle and rectangle. The rectangle has a base of 10 centimeters and a height of 12 centimeters. The triangle has a base of 4 centimeters and a height of 12 centimeters.

A trapezoid was broken into a triangle and rectangle.

The area of the rectangle is _____cm2.

The area of the triangle is ______cm2.

The area of the trapezoid is ______cm2.

Answers

Answer:

area of rectangle = 120 cm²

area of triangle = 24 cm²

area of trapezoid = 144 cm²

Step-by-step explanation:

12 * 10 = 120

12 * 4 = 48

48 / 2

add the triangle and rectangle area together

whats the area of this figure?​

Answers

Answer:

area = 396 ft²

Step-by-step explanation:

area = (12 x 19) +(19 x 6) + (9 x 6) = 396 ft²

It cost $730 to put on a school play . How many tickets must be sold at $6 a piece in order to make a profit

Answers

Answer:

122

Step-by-step explanation:

if you do 730 divided by 6 the answer is 121.6666667 so you round it up to 122

The area of a rectangular gymnasium is (5x+5x) square feet. If it is 5x feet wide, what is the length, in feet?
A. x + 1
B 5x
0. 12
D
x + x

Answers

Answer:

Step-by-step explanation:

Area = L x W      gym area is (5x + 5x) ft²      if   W = 5x      Find the L

Area = L x W       divide both sides by W

Area/W  = (L x W) / W

Area/W  =  L  =  Area/W

    L = Area/W

       =  (5x + 5x) / (5x)

       =  5x( 1 + 1) / 5x

       =  5x(2) / 5x                      the 5x's cancel each other  5x/5x = 1

       =   2 ft          I got 2.  I suspect the 12 was a typo and should have been 2

does the volume method length x width x height apply to all volume finding questions

Answers

Answer:

No.

Step-by-step explanation:

This only applies to solids like cubes and some prisms.

It does not apply to such solids are cylinders, pyramids, cones and triangular prisms.  It will apply to a prism whose cross-section is a rectangle.

what do u do when your teacher comments this in a assighnment?."I can't accept this. It is clear that you copied and pasted from the internet. I will give you another chance to do it correctly - using your own thoughts, not the internet." T_T my teacher found out ......:((

Answers

Answer:

Deny. Deny. Deny.

Step-by-step explanation:

Say how crazy the similarities are but you genuinely wrote what came to mind and you did not even look up the topic online. If that fails just grovel and come up with a sob story so they are no so harsh. Hope this helps <3

what is the degree of angle YQR​

Answers

Answer: Angle is 3

Step-by-step explanation:

16x - 27 = 5x + 6

-5x           -5x

______________

11x - 27 = 6

     + 27 +27

___________

11x = 33

__    __

11      11

x = 3

im spending all my points for this smh

Answers

Answer:

Ask a tutor girl under it you will see ask a tutor so click that

would the answer be 36?

Answers

Answer:

No, it would be 72

Step-by-step explanation:

In similar triangles, the sides are different but the angles are the same. You still had a great guess though :)

Pls give brainliest

2) Jill is a pharmaceutical sales-person for Rx 'R
Us. She is paid a monthly salary of $4800
plus 5°. commission on sales. How much yearly
sales does Jill have to generate in order for her
yearly pay to be $50.000?
A) $240.000
B) $250.000
C) $260,000
D) $270,000
E) $280,000

Answers

the answer is C due to process of elimination

Determine the measure of ∠DFB.
Question 6 options:

1) 67°
2) 69°
3) 68°
4) 136°

Answers

Answer:

136

Step-by-step explanation:

Just took the test and got it right good luck with the rest

A train is traveling at a constant speed in miles per hour. Hours (x) Miles (y) Which equation models the data in the table? 1 20 2 100 O y=20x 3 180 O y = x + 80 4 260 5 340 Oy=60x – 80 O y = = 80x — 60​

Answers

Given:

A train is traveling at a constant speed in miles per hour.

The table of value is:

Hours (x)     Miles (y)

     1                  20

     2                 100

     3                 180

     4                 260

     5                 340

To find:

The equation for the given data table.

Solution:

It is given that the train is traveling at a constant speed in miles per hour. So, it is a linear relationship.

Choose any two point from the given table of value. Let the two points are (1,20) and (2,100). So, the equation of the line is:

[tex]y-y_1=\dfrac{y_2-y_1}{x_2-x_1}(x-x_1)[/tex]

[tex]y-20=\dfrac{100-20}{2-1}(x-1)[/tex]

[tex]y-20=\dfrac{80}{1}(x-1)[/tex]

[tex]y-20=80(x-1)[/tex]

Add 20 on both sides.

[tex]y=80(x-1)+20[/tex]

[tex]y=80x-80+20[/tex]

[tex]y=80x-60[/tex]

Therefore, the correct option is D.

Given f(x) = 2x ^ 2 + kx - 20 and the remainder when f(x) is divided by x - 10 is 90, then what is the value of k?

Answers

Answer:

k =  -9

Step-by-step explanation:

f(x) = 2x²+kx-20

From remainder theorem,

x = 10 and f(10) = 90

f(10) = 90

Subsitute the value of x into the expression above.

f(10) = 2(10²)+10k-20 = 90

200+10k-20 = 90

Solve for k by collecting like terms

10 k = 90+20-200

10k = 110-200

10k = -90

k = -90/10

k = -9.

Hence the value of the constant is -9

You travel 30 miles per hour for 4.2
hours. How far did you travel?

Answers

Answer:

126 miles

Step-by-step explanation:

If I remember right, you'll have to multiply 30 by 4.2 and get 126 miles since each hour is 30 miles.

Rewrite the function f (x) = 3 (x - 1)^2 – 2 in the form f(x) = ax^2+bx+c

Answers

Answer: 3x^2-6x+1

Step-by-step explanation:

In this question, you just have to foil out the expression and multiply things out to get the results. Rewrite it if you need so you can caluate it like what I did in this picture.

3(x-1)^2-2
3(x^2-2x-1)-2
3x^2-6x-3-2
F(x) = 3x^2-6x-5

100 PTSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS
The width of a rectangular field is represented by x. The length of the rectangle is 5 more feet than the width. The total area of the field is 24 square inches. Write an equation to represent the area of the rectangle.

Answers

Answer:

24 ÷ x = 5

i hope this helps :)

Answer:

It is 24 ÷ x = 5

Step-by-step explanation:

The sum of two numbers is 51. The smaller number is 17 less than the larger number. What are the numbers?
Larger number
smaller number

Answers

Answer:

smaller number = 17, larger number = 34

Step-by-step explanation:

Let x be the smaller number and y be the larger nuber

x + y = 51 --(1)

y - 17 = x  --(2)

Sub (2) into (1)

y - 17 + y = 51

y = 34

Put y = 34 into (2)

34 - 17 = x

x = 17

Ans: smaller number = 17, larger number = 34

Answer:

Let get large number is x and small number as y.

sum of two numbers is 51.(small number + large number = 51)

ie. x +y =51 --------(1)

The smaller number is 17 less than the larger number.

x-y = 17 ------------(2)

(1) +(2);

(x + y ) + (x - y) = 51 +17

2x = 68

x=34

Substituted for (1);

x + y =51

34 + y =51

y= 51  -34

y= 17

Step-by-step explanation:

Sarah is designing a flower garden and has allowed herself $300 for expense. she finds flowers for $6 each and bushes for 10$ each which of the flowing combination of flowers and bushes could Sarah buy considering her budget.

13 flowers and 23 bushes
16 flowers and 21 bushes
8 flowers 26 bushes
25 flowers 14 bushes

Answers

Answer:

25 flowers 14 bushes

Step-by-step explanation:

13f/23b = 308

16f/21b = 306

8f/260 = 308

25 · 6 = 150

14 · 10 = 140

140+150 = $290

Sarah can buy 25 flowers and 14 bushes considering her budget.

What is an Equation?

An equation is the statement of two expressions located on two sides connected with an equal to sign. The two sides of an equation is usually called as left hand side and right hand side.

Let x be the number of flowers and y be the number of bushes.

Total expense = $300

Cost for each flower = $6

Cost for each bush = $10

We get an equation,

6x + 10y = 300

(a) 13 flowers and 23 bushes

Total cost = (6 × 13) + (10 × 23) = $308

(b) 16 flowers and 21 bushes

Total cost = (6 × 16) + (10 × 21) = $306

(c) 8 flowers 26 bushes

Total cost = (6 × 8) + (10 × 26) = $308

(d) 25 flowers 14 bushes

Total cost = (6 × 25) + (10 × 14) = $290

Hence the possible combination is 25 flowers and 14 bushes.

Learn more about Equations here :

https://brainly.com/question/29657988

#SPJ2

Two cars are side by side. One is 3.9 meters long. The other is 6% shorter. How long is the second car?

Answers

Answer:

3.66meters long

Step-by-step explanation:

since it's 6% shorter you calculate 3.9 times .94(which is basically 94 percent) which gives you 3.66 meters long

39.96÷6 with explanation​

Answers

Answer:

39.96/6=6.66

Do the long division

39/6=6 R3

Step-by-step explanation:

Answer:

hope help you stay happy

Plz, answer this question plz!

Answers

Answer:

the second option im pretty sure

Answer:

4/48. I don't know for sure, but I think B is the correct answer

PLEASE HELPPPPP MEEEEE !!!!

Answers

You know the hypotenuse and the relevant angle and x is adjacent to this

Cos?= adj/hyp
Cos45=x/ root6 |multiply both side by root 6 to get rid of fraction

root6 x cos45 = x
x = root 3

A school sold tickets to a musical,
The school received $5.25 per ticket sold.
Write an equation that represents the relationship between the number of tickets sold and the tota
Let t = the total amount of money collected and n = number of tickets sold.

Answers

T=5.25n......................

PLEASE HELP:,). The difference between the two numbers is 12. If you increase the first number by 2 and decrease the second number by 10, the first number is 9 times larger than the second. Find these numbers.

Answers

Answer:

25 and 13

Step-by-step explanation:

25 - 13 = 12  

25 + 2 = 27

13 -10 =3

27 is 9 times larger than 3

Other Questions
Read the following sentence:Some kinds of water quality can be checked right in the stream or at the well.Which answer correctly uses domain-specific language to strengthen the writing? A)Some aspects of water quality can be determined directly in the stream or at the well.B)Some kinds of water quality can be figured out right in the stream or at the well.C)Some types of water quality can be tested right in the stream or at the well.D)Some aspects of water quality can be checked right in the stream or at the well. Please complete the following DNA strands1. AGGTCCAAGCTCAAATTTCCCC2. GAAACCCCTTAAACCTTAATTCC3. GCGCGCGCAAATTTTTCCCATCTPlease complete the following strands using RNA:1. AGGTCCCAAAGGCCCTTTCC2. UAAAGGGCCCAGCCCACC3. CUAAAAGGGGGUUUUAACC What is 1/12 cups converted into ounces? Match the countries and their aims after World War I.GermanyFranceItalyUnited Stateswanted to establish a lasting peace in Europewanted a treaty based on the armistice it had signedwanted territories near the Adriatic that Britain had earlier promisedwanted to punish and weaken Germany Plz, answer this question plz! Plz, answer this question plz! Plz, answer this question plz! Plz, answer this question plz! Plz, answer this question plz! I need help with these two questions Bob ate 1/3 loaf of bread over 4 days. He ate the same amount of bread each day. What fraction of the loaf did Bob eat each day? danielle did not complete 15 of her 200 assignments last year. Kim said that is 0.075 of her assignments and Kelly said it is 0.75 of her assignments. Who is correct and how do you know? A ___________ is a large volcano built up of alternating layers of lava and ash, or cinders.a.stratovolcanoc.cinder coneb.shieldd.stratus volcanoPlease select the best answer from the choices providedBRAINLYIST PROVIDED I NEED HELP GUYSDid the French Revolution achieve its goals? Why ? Or why not? the cost of lunch l after a 15% tip can be represented by the expression l + 0.15l. Simplify the expression. Then determine the total cost of the lunch after the lunch bill is $10. Please somebody answer fast I really need this answer Leading up to the signing of a contract with an integration clause, a buyer sent an e-mail to the seller of a beautiful, new $45,000 boat asking, "You provide financing, right?" The seller responded, "Yes, of course." The contract, which the parties signed yesterday, said nothing about financing. Right after signing, the seller said, "OK, let's get you set up with financing!" He then ran the buyer's credit, which was not good. The buyer was not approved for financing through the seller's only source. The buyer believes that he, therefore, is not liable for the cost of the boat. Is the buyer correct? Work out the length x.17 cm9 cm Here is an expression 3*2t. Evaluate the expression when t is 1 What is radioactive dating?A. A comparison of the energy emitted from nuclei based on ageB. The determination of how old a radioactive isotope isC. The use of radioisotopes to determine the age of somethingD. A process to determine the half-life of a radioactive isotope Plagiarism can be defined in all of the following ways EXCEPT:A. deliberate, unacknowledged use of someone else's language, ideas, or other original materialB. presenting false or fabricated data or sourcesC. submitting the same paper for more than one course without the instructor's permissionD paraphrasing what someone else said and using parenthetical citations to give credit A dolphin is swimming at a depth of 3.4 meters with respect to sea level when it begins diving deeper at a constant rate of 0.25 meter per second. In how many seconds will the dolphin reach a depth of 9.9 meters below sea level? one, no, or infinitely many solutions How do you graph the equation, 2x+3y=12