PLEASE HELP WILL GIVE BRAINLIEST

What is the source of bacteria which cause illness?
Question 2 options:

Rocks


Other bacteria


Soil


Miasma

Answers

Answer 1

Answer:

Other bacteria can BUT miasma causes a lot.

Explanation:

miasma causes illnesses like the cold, malaria, influenza etc...!

Hope this helped <3


Related Questions

What structure do white blood cells use to engulf bacteria when they do phagocytosis?
A. cilia

B. flagella

C. pseudopod

D. oral cavity

Answers

The engulfed object is thus enclosed within a membrane-bound vacuole called a phagosome. The phagocyte digests the ingested particle with hydrolytic enzymes, which are contained within membrane-enclosed sacs called lysosomes found within the cell.

Which of the following choices includes two structures that are found in plant cells, but not in animal cells?
A.) cell wall
B.) chloroplasts , ribosomes
C.) lysosomes, mitochondria
D.) cell wall, large central vacuole

Answers

Answer:

the answer is d hope this helps

i'll give brainliest

Answers

Answer: B. S cycle

Explanation: The S phase of a cell cycle occurs during interphase, before mitosis or meiosis, and is responsible for the synthesis or replication of DNA.

The answer is S. It’s replicated in the S face

What is the geologic column?
A. a sequence of rock layers with known rock
and fossil formations
B. a column of dense ore that holds together
rock layers
C. an extremely deep hole that reaches the
bottom of Earth's crust
D. an area where fossils from every time period
resurface

Answers

The answer should be A
Answer:
The answer is a

can all the plants prepare their food? why?​

Answers

Some plants do make their own food but some dont

Difference between plants and animals​

Answers

Answer:

plants are live in soil and animals are live in religion

Explanation:

dont judge me if im wrong

animals have to move around to find their food but plants create their own food through photosynthesis. therefore, animals can’t produce their own energy, while plants get the energy needed from the sun

If a fatty acid has 17 Cardons and 34 oxygens, you know that is...
1. None of the above
2.Polyunsaturated
3.Monounsaturated
4.Saturated

Answers

Answer:

is 3

Explanation:

becouse is correct

Are brown eggs more nutritious than white eggs?

Answers

Answer:

Often, people who prefer brown eggs do so because they believe brown eggs are more natural and healthy than white eggs. However, the truth is that all eggs are nutritionally very similar, regardless of size, grade or color (2, 6, 7). Both brown and white eggs are healthy foods.

Explanation:

Answer: no

Explanation:

Both types of the eggs have the same types of nutrients. White eggs and brown eggs are both nutritious. The answer to your question is no, white eggs and brown eggs have the same amount of nutrients.

why hydra is example of both budding and regeneration?​

Answers

Answer:

Organisms such as hydra use regenerative cells for reproduction in the process of budding. In hydra, a bud develops as an outgrowth due to repeated cell division at one specific site. These buds develop into tiny individuals and, when fully mature, detach from the parent body and become new independent individuals.

Explanation:

PLZ HELP ME I NEED THIS ASAP IT WAS DUE 3 DAYS AGO 15 POINTS AND BRSINLIES TO FIRS ANSWER Sponges
Cnidarians
Roundworms
Annelids
Mollusks
Arthropods
Echinoderms
Vertebrates


Questions

1. Which grouping in the animal kingdom is the only one that contains organisms with vertebrae?







2. Which grouping has the least complex body plan? If you were on a research expedition in the kingdom of Tonga, a coral atoll in the South Pacific, would you find these organisms?

Answers

Answer:

Question 1: Vertebrates

Question 2: Porifera, and yes you would find it.

Explanation:

Vertebrates are the only one with a backbone. And porifera is a sponge, which has a very basic body plan. It would be found there.

what happens in people that have this difference in their DNA?

Answers

Answer:

Explanation:

DNA comes in long strands called chromosomes, which are kept inside the nucleus of a cell. Every one of our cells has a nucleus with all of the DNA. Each cell is different not because of the bits of DNA in it, but because of the bits it uses to make things.

Each strand of DNA is made up by joining together nucleotides. There are four different nucleotides called adenine (A), thymine (T), cytosine (C) and guanine (G). If you could see the nucleotides in a strand of DNA it would look something like this: AACGTATTGACATAGGGGGGCCTACTTA

It is quite extraordinary that just four different nucleotides make up the code of every single living thing. The order that these nucleotides are in determines the difference between a brain cell, a toenail, a blood cell and whether or not we have a certain disease.

So if you wrote out the DNA sequences of two people and matched them up together, they would look almost exactly the same. There would be about 1 difference in every 100 nucleotides (it’s actually more like 1 in 1000). These differences determine whether you have blonde hair or brown, whether you are tall or short, whether you will have asthma or not.

You are more similar to people you are related to because your DNA came from the same place; your great, great, great grandparents, or something like that. Your DNA is a combination of your Mum and Dad’s DNA, half from each. So you are half the same as your Mum, half the same as your Dad. If you looked at the DNA of a friend you are not related to, they would also be half the same as their Mum, and half the same as their Dad, but they would be quite different to you. This is because the last common ancestor (person who is related to you both) was so many hundreds or thousands of years ago, that a lot of changes have occurred in the DNA sequence since then.

When the given type of mutation happens, the round shape of the R.B.Cs changes from a round shape to a sickle-like shape. This condition is known as sickle shape anemia.

What is sickle-shaped anemia?

Sickle-shaped anemia is a genetic disorder. In this disease, the shape of the red blood cells changes to sickle-like. The red blood cells of sickle shape are not healthy. They die early and easily. This condition causes a shortage of healthy red blood cells. The symptoms are low red blood cells, block blood flow, pain in the body, dizziness, joint pain, blurred vision, and headache.

Patients who suffer from that condition are likely to have episodes of pain. This is known as a vaso-occlusive crisis. The pain can last from one week to two weeks.

Learn more about sickle-shaped anemia, here:

https://brainly.com/question/28548594

#SPJ2

How might we investigate how some people survive a pandemic and others do not?

Answers

By checking whether they are infected or not by health check-up. Like their temperature, or probably blood test.

Or, if you are talking about precentage, usually its from the hospital that are reporting the number of people who are infected.

40.) A common garden pest is the slug. They are covered in slime and they 1 eat vegetable leaves. Gardeners will put salt on a slug if they see one in their garden. Part A: What type of transport is occuring when salt is placed on a slug? Give the broad (general) category of transport and the specific type of transport in your answer. (Should have two answers)​

Answers

Answer:

osmosis

Explanation:

Describe the function of each organelle nucleus

Answers

The nucleus is the control centre of a cell as such it is the most important part of the cell. ... Structure - The nucleus is a large roundish organelle. It is bounded by a double membrane which has numerous pores. Inside the nucleus are chromosomes and a dark region called a nucleolus which makes ribosomes.

Answer:

Directs cell activity

Explanation:

EDGE 2022

please explain how respiration is the opposite of photosynthesis.​

Answers

The are complete opposites as photosynthesis removes carbon dioxide from the sky/atmosphere while respiration puts back the carbon dioxide as it uses oxygen and carbon dioxide is like the waste of it

-hope this was helpful so you can mark it as brainlest

Please Answer this one MCQ. I am in trouble please help ..​

Answers

Answer:

H is a motor nueron

J is the sensory nueron

G is the internueron

Explanation:

Your drawing seems a little bit of so I hope I get it right!. I know that Relay neurons are found in the brain and spinal cord and allow sensory and motor neurons to communicate. Motor neurons are found in the central nervous system and control muscle movements.

Describe what plants need to survive

Answers

Plants need water, sunlight, and good soil to generally survive.

Answer:

All plants need these seven things to grow: room to grow, the right temperature, light, water, air, nutrients, and time.

Explanation:

THIS _________________ HAPPENS AUTOMATICALLY WITH A CELL IF ITS __________________ IS PERMEABLE TO THE ________________ AND IF THERE IS A DIFFERENCE IN _______________________ OF THE MOLECULES ON EITHER ___________ OF THE MEMBRANE. THIS IS __________________ ____________________.

Answers

Answer:

movement; cell membrane; molecules; concentration; side

THIS IS know as diffusion

Explanation:

Diffusion is the movement of molecules from the side of the membrane with a higher concentration to the side of the membrane with a lower concentration. Facilitated diffusion is a process that occurs if the cell membrane is permeable to these molecules and if there exists a difference in the concentrations on the two sides of the membrane. This mechanism is also known as passive transport because no energy is needed for the movement of molecules across the membrane.

How is the Grand Canyon a "geologic time
machine"?

Answers

Answer:

because of joe dirt

Explanation:

A teacher challenges her students to each build a solar oven using common household materials. The students will then test their designs using thermometers. What engineering problem are they trying to solve?

Answers

Answer:

Climate issues associated with engineering works

Explanation:

A teacher challenging her students to each build a solar oven using common household materials is highly commendable. The students using this method will help in solving the engineering problem of climate issues.

This will help in the reduction of emission of greenhouse gases which causes global warming. Solar energy on the other hand is renewable and free from emission of such gases.

True or False:
Changes in the crust happen quickly and can easily be seen

Answers

Answer:

False, they take a long time

Explanation:

A portion of grass in a prairie ecosystem was destroyed by wildfire. What will most likely happen to the population of bison that feed on the grass? a. The number of bison will increase. b. The number of bison will decrease. c. The bison in the ecosystem will be completely wiped out. d. The number of bison will remain unchanged. Please select the best answer from the choices provided A B C D

Answers

Answer:

B

Explanation: I’m just using common sense. If part of the prairie grass is destroyed, that would mean less food for the bison. Which in turn would result in a decrease of Bison?

Answer:

b. the number of bison will decrease.

Explanation:

the wildfire partially destroyed the bison's ecosystem. With less food for the herd, some of them will starve off, decreasing the number of bison there are in the herd.

1 point
behaviors are described as genetically “programmed" or
"automatic" responses to stimuli.*
innate behavior
learned behavior
social behavior
O
flocking


Answers

Answer:not so goodly and smart

Explanation:

When a cell uses ATP energy to transport a substance through a cell membrane from an area of lower concentration to an area of higher concentration, the cell is using

Answers

Answer:

ACTIVE TRANSPORT

Explanation:

Generally, the transport of molecules across membranes can either be ACTIVE OR PASSIVE. Active transport are those transport that occurs against a concentration gradient i.e. from an area of low concentration of the substance to an area of high concentration, hence, will require energy input in form of ATP.

On the other hand, passive transport occurs down a concentration gradient and hence do not require energy to take place. Hence, based on the description above, when a cell uses ATP energy to transport a substance through a cell membrane from an area of lower concentration to an area of higher concentration, the cell is using ACTIVE TRANSPORT.

Photosynthesis uses sunlight, water and carbon dioxide to create this sugar:
1. water
2. glucose
3. carbon dioxide

Answers

Explanation:

The sugar produced is Glucose. (2)

Explain how slumping or soil creep occur. Will hit heart❤️

Answers

Answer:

Slumps often happen when a slope is undercut, with no support for the overlying materials, or when too much weight is added to an unstable slope. Creep is the imperceptibly slow, steady, downward movement of slope-forming soil or rock.

YEEEEEEEEEEEEEEEEEEEEEEEET HELP ME

Answers

I think it’s A or C

But I mostly think it’s A

HEKLPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP

Answers

Answer:

A

Explanation:

When a light ray hits a mirror which is a shiny object , it reflects in one direction

Have a nice Day , I would appreciate it if you could mark my answer brainliest

Answer A because when a light hits a mirror it goes one way

cellular respiration is a three-part process. Number the processes in the correct order.​

Answers

Answer:

Cellular respiration occurs in three stages: glycolysis, the Krebs cycle, and electron transport.

Explanation:

...need thanks and make me brainiest if it helps you

Answer:

my mom

my dad

my sister

Explanation:

Question 1 (5 points)
Geologic time periods are divided into segments based on two pieces of information.
Describe them.

Answers

Answer:

Geologic time spans are divided into units and subunits, the largest of which are eons. Eons are divided into eras, which are further divided into periods, epochs, and ages.

Explanation:

Other Questions
In the Lewis structure for FeF3, how many lone pairs surround the iron atom?NEED ASAPSelect one:a. 0b. 1c. 2d. 3Clear my choice Keisha wants to buy a stereo. Her mother said if Keisha saved 75% of the cost of the stereo, she would pay the other 25% and the taxes. If the cost of the stereo is $150.00, how much money does Keisha need to save?Keisha needs to save $________???HURRY PLS Is hemoglobin a hormone? 9. After Princess Diana was killed, Sir Elton John wrote that she lived her life "like a candle in the wind."You can infer that Sir Elton thought Princess Diana's life wasA. too brief.B. unsuccessful.C. full of bright lights. Which of the following statements about traditional IRAs is TRUE?Taxable invelliment income, such as interest, dividends, and capital gains, will qualify as compensation for the purpose of contributing to an IRA.Taxpayers may be able to reduce their tax liability by contributing to an IRA after the tax year has ended.Taxpayers with a timely filed extension have until October 15 of the tax year to establish and contribute to an IRA.Taxpayers who participate in an employer-sponsored retirement plan are prohibited from contributing to an IRA.Mark for follow up make a long paragraph. What is Columbuss point of view in his letter to the Treasurer of Spain? * what is the percent of change from 300,000 to 30,000 its 90 Uniti-Ready26) Paige walks to the park mile 2/3 away. It takes her 16 minutes to get there. Paigeher speed in miles per minute.Which fraction represents Paige's wants to know speed in miles per minute? wwwwwwwwwwwwwwwweeemem2lm;2rnwejtnrjqktnqrjtnij;tnq43i;ntlhqrntbjqnlrjkebtgqrejtglqrjtnhtnhftkhkntiltnoeiqhtknefiothefwntbqotq43uhi413hto3u so it is 12 Please help me! 10 pts and brainliest! PleaseWhich equation can be solved to find the value of y in this diagram? The pic is above!A. y+ 116 + 30 = 180B. y-116 - 30 =360C. y+116 + 30 - 360D. y-116 - 30 = 180 Lifestyle behaviors that can helps prevent disease (check all that apply )1. Get a good night rest2. Prevent sun damage 3. Get health screenings Robert needs to know if the triangle shown is a right triangle. Which equation could he use to help? A. 36+ 25= 49B. 25 + 36 = 49 C. 25 2 + 36 2 = 49 2 D. 36 2 25 2 = 49 2 which of the following is not one of the influencing factors when it comes to body type solve the following equation-7x-4y=-4 -9x-5y=-6 Rachel's biscuits require 0.75 cup of milk for 1 batch. Use dimensional analysis to convert this amount into liters. Use the conversion factors 1 cup/0.5 pints to convert cups into pints, 1 pint/0.5 quart to convert pintos to quarts, and 1 quart/0.94 liter to convert quarts to liters. Use the correct number of significant digits to give your answer Translate the sentence into an inequality.Twice the difference of a number and3 is at most 16.Use the variable for the unknown number. If Valentina V. Tereshkova had landed on the moon with her equipment and weighed 54 pounds,how much would she have weighed on Earth with equipment? Explain in five or more sentences how are I and my parents be part of service to the Church and to its members. (Christian Living-Not English) 2. How can we tell if a song is in 3/4 time or 4/4 time? Make sure to mention what we can do with our bodies to help us figure out the time signature and how the time signature will sound to our ears if it is correct.egd 2020 Read the topic from Immigrant Kids by Russell Freedman.Immigrant families worried about being torn apart from one another.Which quotation best develops this topic?we lived there for three days - Mother and we five children, the youngest of whom was three years oldmy first impressions of the New World will always remain etched in my memoryscowling and gesturing, they pushed and pulled the passengers, herding us into separate groupsclustered on the foredeck for fear of separation and looked with wonder on this miraculous land of our dreams