The Levine family has 10 gallons of gas in the car. The car uses 1 5/8 of a gallon each hour. How long can they drive on 10 gallons of gas?

Answers

Answer 1

Answer:

6.15

Step-by-step explanation:

10 gallons is 80/8

1 5/8= 13/8

80 divided by 13 is 6.15384615385 but rounded 6.15

6.15 hours

if its not that then keep rounding to 6.2 or 6hrs


Related Questions

HELP! I don't understand

Answers

Answer:

Step-by-step explanation:

Find two numbers whose sum 7500 and whose product is the maximum value.
(Round your answer to the nearest whole number.)
Blank = 1
Blank = 2

Answers

The two numbers whose sum is 7500 and whose product  is a maximum value are 3750 and 3750.

Let the two numbers be x and y.

Since their sum equals 7500,

x + y = 7500  (1)

Their product f(x,y) = xy  (2)

We desire to maximize the product.

From (1), x = 7500 - y

Substituting x into (2), we have

f(x,y) = xy

f(x,y) = (7500 - y)y

f(y) = 7500y - y²

To maximize the product, we find the value of y that maximizes f(y), we differentiate f(y) and equate it to zero.

So, df(y)/dy = d(7500y - y²)/dy

f'(y)/dy = d(7500y)/dy - dy²/dy

f'(y)/dy = 7500 - 2y

Equating it to zero, we have

7500 - 2y = 0

7500 = 2y

y = 7500/2

y = 3750

To determine if this gives a maximum for f(y), we differentiate f'(y) with respect to y.

So, f"(y) = d(7500 - 2y)dy

f"(y) = 0 - 2

f"(y) = -2 < 0.

So, y = 3750 gives a maximum for f(y) = f(x, y)

Since x = 7500 - y

Substituing y = 3750 into the equation, we have

x = 7500 - 3750

x = 3750

So, the two numbers whose sum is 7500 and whose product is a maximum product are 3750 and 3750.

Learn more about product of two numbers here:

https://brainly.com/question/15607519

In an A.P. if Tₚ = q and Tq = p, then find the rth term.
Please solve this problem​

Answers

Formula:

We know that

nth term of the AP is Tn = a+(n-1)d

Where, a = First term

d = Common difference

n = number of terms

Now,

Given that

pth term of the A.P. = Tp = q

⇛a + (p-1)d = q

⇛(p-1)d = q - a

⇛d = (q-a)/(p-1) →→→→(i)

and

qth term of the A.P. = Tq = p

⇛a + (q-1) d = p

⇛ (q-1)d = p-a

⇛ d = (p-a)/(q-1) →→→→(ii)

From Eqn(i) and Eqn(ii)

⇛(q-a)/(p-1) = (p-a)/(q-1)

On applying cross multiplication then

⇛(q-a)×(q-1) = (p-a)×(p-1)

⇛q²-q-aq+a = p²-p-ap+a

⇛q²-q-aq = p²-p-ap

⇛ap-aq = p²-p+q-q²

⇛a(p-q) = (p²-q²)-(p-q)

⇛a(p-q) = (p+q)(p-q)-(p-q)

⇛ a(p-q) = (p-q){(p+q)-1}

On cancelling (p-q) both sides then

⇛a = (p+q-1) →→→→Eqn(iii)

On Substituting the value of a in Eqn(ii) then

⇛ d = [p-(p+q-1)]/(q-1)

⇛d = (p-p-q+1)/(q-1)

⇛d = (-q+1)/(q-1)

⇛d = -(q-1)/(q-1)

⇛d = -1

We have,

a = p+q-1 and d = -1

Now, rth term of the AP

⇛ Tr = a + (r-1)d

⇛Tr = (p+q-1)+(r-1)(-1)

⇛ Tr = p+q-1+(-r+1)

⇛ Tr = p+q-1-r+1

⇛ Tr = p+q-r

Therefore, Tr = p+q-r

Answer: rth term of the given A.P. is p+q-r

Answer:

rth=q+p+qxp

Step-by-step explanation:

rth= 3 of the T and Tq added together and joined.

If a person walks 1/3 mile in 15 minutes, how far will that person walk in one hour?

Answers

Answer: 1 1/3 miles

Step-by-step explanation:

Since we know that an hour is 60 minutes, and 60 divided by 15 = 4, then we can multiply 1/3 times 4 to get the total number of miles in 60 minutes.

1/3 X 4 = 4/3

4/3 = 1 1/3

Therefore, the answer is 1 1/3 miles.

Answer:In an hour, a person will walk 4/3 mile.Step-by-step explanation:1/3 mile = 15 minutes=> 1/3 mile x 4 = 15 x 4 minutes=> 4/3 mile = 60 minutesConclusion:

Therefore, in an hour, a person will walk 4/3 mile.

Hoped this helped.

[tex]BrainiacUser1357[/tex]

Evaluate the expression for m = 45.
m|
54
Submit

Answers

[tex]|m| -54\\\\\text{When}~ m=45,\\\\|45| -54 = 45 -54 = -9[/tex]

[tex]\huge\textbf{Hey there!}\\\\\\\\\\\\\\\huge\boxed{\mathbf{|m| - 54 = }}\\\huge\boxed{\rightarrow \mathbf{|45| - 54 = }}\\\huge\boxed{\mathbf{\rightarrow 45 - 54}}\\\\\huge\text{Start at 45 and go back 54 to the left.}\\\huge\text{You should be left on \boxed{\bf -9}}\\\\\\\huge\textbf{Therefore, your answer is: \boxed{\mathsf{-9}}}\checkmark\\\\\\\\\\\\\\\huge\textbf{Good luck on your assignment \& enjoy}\\\huge\textbf{your day!}\\\\\\\\\\\\\\\frak{Amphitrite1040:)}[/tex]

Write -37.75 as a mixed number.​

Answers

Answer:

[tex]-37\frac{3}{4}[/tex]

Step-by-step explanation:

0.75 is equivalent to three quarters, or (3/4).

3/4 would be the fraction. -37 would be the whole number.

[tex]-37.75 = \boxed{-37\frac{3}{4}}[/tex]

Hope this helps.

Answer:

- 37 3/4

Step-by-step explanation:

Which of the following graphs is described by the function given below?
y = 2x2 + 6x + 3
5
101
10
10
-20
20
- 10
10
-10
20-
101
A.
B.
C.
D.
A. Graph A
B. Graph B
O C. Graph C
D. Graph D

Answers

Answer:

Which of the following graphs is described by the function given below?

y = 2x2 + 6x + 3

-A. Graph A

The function y = 2x^2 + 6x + 3 is a quadratic function that has a vertex of (-1.5,-1.5)

How to determine the graph of the function?

The equation of the function is given as:

y = 2x^2 + 6x + 3

Differentiate

y' = 4x + 6

Set to 0

4x + 6 = 0

This gives

4x = -6

Divide by 4

x = -1.5

Substitute x = -1.5 in y = 2x^2 + 6x + 3

y = 2(-1.5)^2 + 6(-1.5) + 3

Evaluate

y = -1.5

This means that the function y = 2x^2 + 6x + 3 has a vertex of (-1.5,-1.5)

See attachment for the graph of y = 2x^2 + 6x + 3

Read more about quadratic graphs at:

https://brainly.com/question/18797214

#SPJ5

W/5+20=22. How do I do this

Answers

Answer:

W = 10

Step-by-step explanation:

W / 5 + 20 = 22

W / 5 - 20 = 22 - 20

W / 5 = 2

W * 5 = 2 * 5

W = 10

Step-by-step explanation:

[tex] \frac{w}{5} + 20 = 22 \\ \\ \frac{w}{5 } = 22 - 20 \\ \\ \frac{w}{5} = 2 \\ \\ w = 5 \times 2 \\ \\ w = 10[/tex]

Determine if a relation is a function {(-1,5), (2, 7), (-3,2), (-1, 1)}

Answers

The relation is NOT a function

Answer:

Step-by-step explanation:

A relation is only a function if ALL the x-values (the first number in the pairs) ONLY have one partner.

Check that -1

At first that -1 is paired up with a 5 in the ordered pair (-1, 5) but then later... that -1 is down there hanging out with a 1 in the last ordered pair (-1, 1).

This means that this relation (all the pairs lumped together) is NOT a function. Just because of that -1 pairing up with more that one partner.

Which symbol correctly compares the two angle measures? pi/4 radians_____30°
A. <
O B. >
C. =
I don't know the answer and thats my guess :,)​

Answers

Answer:

B. [tex]\frac{\pi }{4} Rad>30^{0}[/tex]

Step-by-step explanation:

[tex]\frac{\pi }{4} Rad=(180/4)^{0} =45^{0}[/tex]

Hope this helps

I MARK BRAINLIEST AND 50 points!!! find the magnitude of the resultant. forces of 92.6 lb and 118 lb act on an object. the angle between the forces is 75.2°.
a) 208 lb
b) 130 lb
c ) 168 lb
d) 150 lb

Answers

Answer:

This a vector addition problem and you need to know the law of cosines and law of sines to solve this problem.

Two vector forces of 80lbs and 70 lbs act on an object at 40 degree angle between them.

The magnitude of the resultant force can be found by applying the law of cosines:

c2 = a2 + b2 - 2abcos140°

where a = 80, b = 70 and c is the resultant force vector you are asked to find

Once you find the magnitude of the resultant force, then you can find the angle it makes wrt the 70lb force using the law of sines:

sinα/a = sin140°/c

where α is the angle opposite side a, or the angle between the resultant and the 70lb vector that you are asked to find. so it would be 140lbs

Step-by-step explanation

2x-y=3
X+y=3
Slove equations algebraially

Answers

These are simultaneous equations

Add the two equations together and get

3x = 6

x = 2

2 + y = 3

y = 1

Find the value of x. Round to the nearest degree.

Answers

Ok done. Thank to me :>

Don Swifter earns $9.75 per hour as a clerk. He starts work Monday through Friday morning at 8:00 AM. He takes a one-half hour lunch break every day. If he finishes work at 3:30 PM Monday through Thursday, how late must he work on Friday to have total pay of $360.75 for the week?

Answers

Answer:

He works until 5:30.

Step-by-step explanation:

ok so first, every day don would take a total of 7 hours and 30 minutes on mon-Thurs. If we subtract his lunch from that total it would be 7 hours so next we do 7 hours times 9.75 which is 68.25$. Now that we know how much he makes per day, we times that by 4 since mon-thurs is 4 days. This would be 273$. Now we need to get to 360.75 so we subtract that. This would be 87.75$. Now if a normal day is 68.25$ and friday is 87.75, we find the diffrence which is 19.50. which is also 9.75(an hour) x 2 resulting in 2 hours extra. Therefore, he works 9 hours and 30 minutes on fridays (until 5:30). Thanks for putting in the work to understand and have a nice day!

Don must work approximately 9 additional hours on Friday to have a total pay of $360.75 for the week.

How to determine how late he must work

Don works from 8:00 AM to 3:30 PM Monday through Thursday. Let's calculate his total work hours for these four days:

Total work hours from Monday to Thursday:

(3:30 PM - 8:00 AM) - 0.5 hours (lunch break)

= 7.5 hours - 0.5 hours

= 7 hours (per day)

Total work hours for the week (Monday to Thursday):

4 days x 7 hours/day = 28 hours

Total pay for the week = Hourly rate x Total work hours + Additional hours on Friday

$360.75 = $9.75 x 28 hours + Additional hours on Friday

Additional hours on Friday = ($360.75 - $9.75 x 28) / $9.75

Additional hours on Friday = ($360.75 - $273) / $9.75

Additional hours on Friday = $87.75 / $9.75

Additional hours on Friday ≈ 9 hours (rounded to the nearest hour)

Learn more about work hours

https://brainly.com/question/3164396

#SPJ3

A 3-inch candle burns down in 4 hours. If b represents how much of the candle, in inches, has burned away at any time given in hours, t, write a proportional equation for b in terms of t that matches the context

Answers

use this equation:

b+t+3+4

Look at the top questions. Pls I need help asap I don’t get it

Answers

X is the bottom and y is the left side an it should be straight

I want a way to solve such a problem​

Answers

Answer: please calculate the answer.

Step-by-step explanation:\\ Bro use this formula (sum of all numbers of the question) \ no. of seen numbers.

Arithmetic mean = ( 24+124+243+...) \ 12

What is the slope of the line?

Answers

Answer:

[tex]-\frac{1}{3}[/tex]

Step-by-step explanation:

If we take points [tex](1,1)[/tex] and [tex](4,0)[/tex] from the line, we can determine the slope:

[tex]m=\frac{\Delta y}{\Delta x}=\frac{y_2-y_1}{x_2-x_1}=\frac{0-1}{4-1}=\frac{-1}{3}=-\frac{1}{3}[/tex]

Therefore, the slope of the line is [tex]-\frac{1}{3}[/tex]

please help me on this one would be great help.

Answers

t = 60

please mark me brianliest

Answer:

60

Step-by-step explanation:

Help...................

Answers

Step-by-step explanation:

the surface area of that object consists of

2 triangles (one left, one right)

1 rectangle at the top

1 rectangle at the bottom

1 rectangle in the back

so, we need to calculate the area of each of these 5 areas and sum them up. that's it.

the area of such a triangle is

6×8/2 = 24 m²

we have 2 such triangles, so in total they are 48 m².

the rectangle at the top

10×12 = 120 m²

the rectangle at the bottom

12×8 = 96 m²

the rectangle in the back

12×6 = 72 m²

so the total surface area is

48 + 120 + 96 + 72 = 336 m²

2. Scholarships The probability that Samantha will be accepted by the college of her choice and
obtain a scholarship is 0.35. if the probability that she is accepted by the college is 0.65.
Find the probability that she will obtain a scholarship given that she is accepted by the college.
(4 pts)

Answers

The probability that she will obtain a scholarship given that she is accepted by the college is 0.54.

Given that the probability that Samantha will be accepted by the college of her choice and obtain a scholarship is 0.35, to determine, if the probability that she is accepted by the college is 0.65, the probability that she will obtain a scholarship given that she is accepted by the college, the following calculation must be performed:

0.65X = 0.35 X = 0.35 / 0.65 X = 0.538

Therefore, the probability that she will obtain a scholarship given that she is accepted by the college is 0.54.

Learn more about maths in https://brainly.com/question/26075432

Find the equation that represents the proportional relationship in this graph, for y in terms of x.

Answers

Answer:

y = 0.4 x

Step-by-step explanation:

Try changing these improper fractions to mixed numbers.
16/5?

( teach me how to solve this please!)

Answers

Answer:

3 1/5

Step-by-step explanation:

The improper fraction 16/5 is called improper because the top number(the numerator) is bigger than the bottom number(the denominator) we "fix" this by dividing and creating a mixed number (it is called mixed because there is a whole part and a fraction part):

As 16÷5 >>> doing this division gives you 3 wholes and 1/5 leftover. We write this as

3 1/5 (in handwriting the three is big and the 1/5 is a fraction, it is the mixed number they are asking you for)

What is that answer Share 126 gallons of petrol between Steve and Dave in the ratio 2:5

Answers

5+2=7 parts in the ratio
126÷7=18 gallons per part
s:d
18x2:18x5
36:90

1/2x + 4 = 10
solve the following equation algebratically. Show the work to support the answer.

Answers

Answer:

(1/2)x + 4 - 4 = 10 - 4

2(1/2)x = 6 * 2

x = 12

What is the second number in the sequence?

Answers

Answer:

Step-by-step explanation:

Let "n" be the second odd number in the sequence

(n - 2) + n + (n + 2) + (n + 4) + (n + 6) = 135

                                              5n + 10 = 135

                                                      5n = 125

                                                        n = 25

23 + 25 + 27 + 29 + 31 = 135

Perform the indicated operations/solutions.
1. 12-7+45÷15x11=
2. 16x2+12-18÷9-4=

Answers


1. 12-7+45÷15x11=50.6
2. 16x2+12-18÷9-4=38

1 A polynomial expression of degree three is shown below.
8x3 + 125
Which expression represents the correct factorization of the polynomial?
A (2x + 5)(4x2 + 10x + 25)
B (2x + 5)(4x2 + 10x - 25)
C (2x + 5)(4x2 - 10x + 25)
D (4x + 25)(2x2 - 10x + 5)

Answers

Answer:

D şıkkı iyi dersler hadi

Answer:

C: [tex](2x+5)(4x^2-10x+25)[/tex]

Step-by-step explanation:

First of all, you need to be able to recognize the two terms as cubes, and what they are cubes of. In this case, [tex]8x^3 = (2x)^3[/tex] and [tex]125=5^3[/tex].

Then you have to find a way you like to remember the formula for how to factorize. The way I do it is by saying "the binomial has the same zero as the original, so [tex]x^3+a^3=(x+a)(...)[/tex] and [tex]x^3-a^3 = (x-a)(...)[/tex] and the whole expression has one minus sign attached to the second term of either factor. In the sum of cubes first parenthesis has a plus, so the second term of the other parentesis has to take that minus: [tex]x^3+a^3=(x+a)(x^2-ax+a^2)[/tex] while in the difference of cubes you already used a minus, so everything else goes plus: [tex]x^3-a^3=(x-a)(x^2+ax+a^2)[/tex]

Or you commit the two formulas to memory.

Solve the inequality below for z.
8z+3>3z-17
A.z>-4
B.z<-14/5
C.z<-4
D.z>-14/5

Answers

a.
8z+3 > 3z-17
subtract 3 from both sides
8z > 3z -20
subtract 3z from both sides
5z > -20
divide both sides by 5
z > -4
Answer: z > -4Step-by-step explanation:8z + 3 > 3z - 17=> 8z - 3z > -3 - 17=> 5z > -20=> z > -4Conclusion:

Therefore, the solved inequality is z > -4.

Hoped this helped.

[tex]BrainiacUser1357[/tex]

Explain plzzzzzzzzzzzzzz

Answers

Answer:

8/3

Step-by-step explanation:

x equals 8/3

7x_2_4x_6=0

3x=8 ÷3 in both sides

Other Questions
plumber what work in job In __________ ribosomes can attach to the mRNA and begin translation even though transcription has not been completed. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Is the graph increasing, decreasing, or constant?A. ConstantB. DecreasingC. Increasing Plant and animal cells are both eukaryotic. This means they...O Have a nucleusO Contain DNA and RNA.O Can reproduce on their own. in what year was the first aicpa conference on current sec developments held? what does the suffix ition mean in the word composition HELPPPPP PLSSSS WILL GIVE BRAINIEST!!!!! did thomas jefferson agree with the federalist papers? pls write a paragraph plssss Like the success of animals, the success of plants is limited based on the resources available to each individual. In the tropicalrainforest, plants are especially limited by the spate they have available to grow and reproduce. Which of these statementsdescribes a way that limited space will impactthe success of a plant in the rainforest? (SC.7.L.17.3)A plant without enough space will face increased predation from herbivoresaO A plant without enough space will not have as many parasites and diseases.3A plant without enough space will be more likely to be impacted by air qualityA plant without enough space will not be able to capture enough light to grow. Why do some atoms form chemical bonds while others do not? How did the Spanish-American war aid the U.S. in becoming a global power? Which is the best inference from the author's statement that world war ii ""ended the great depression""? the best inference from the author's statement is that. pleeeeease help meeeeeee perfectly competitive market in long run equilibrium. if demand decreases, we can be certain that price will Which of these statements about game design is FALSE?Game design involvesincorporating user feedback toimprove the platform.Games design is not a STEMcareer because it is just aboutmaking entertainment.Game design is iterative.Game design requires many teammembers with lots of differentareas of expertise. Ocupo poner Palabras homfonas. Activity 3.Direction. Name the ratio as a fraction in simplest form.1. P5.00 to P60.002. 1 hour to 40 minutes3. 2 weeks to 4 days4. Eight out of 30 passengers are tourist. Give the ratio of tourist to passengers.5. For every 45 passengers, 9 are foreigners. Write the ratio of foreigners topassengers.Please answer please help me HELP QUICKLY Why are the deepest high tides so deep and the shallowest low tides so shallow? Hint: how are the Earth, Sun, and Moon aligned? 1 What is the universe made of? ...2 How did life begin? ...3 Are we alone in the universe? ...4 What makes us human? ...5 What is consciousness? ...6 Why do we dream? ...7 Why is there stuff? ...8 Are there other universes? 3. West Fremont is a community consisting of 3,000 homes. A small coal-burning power plant currently supplies electricity for the town. The capacity of the power plant is 12 megawatts (MW) and the average household consumes 8,000 kilowatt hours (kWh) of electrical energy each year. The price paid to the electric utility by West Fremont residents for this energy is $0.10 per kWh. The town leaders are considering a plan, the West Fremont Wind Project (WFWP), to generate their own electricity using 10 wind turbines that would be located on the wooded ridges surrounds the town. Each wind turbine would have a capacity of 1.2 MW and each would cost the town $3 million to purchase, finance, and operate for 25 years.(a) Assuming that the existing power plant can operate at full capacity for 8,000 hrs/yr, how many kWh of electricity can be produced by the plant in a year?(b) At the current rate of electrical energy use per household, how many kWh of electrical energy does the community consume in one year?(c) Assuming that the electrical energy needs of the community do not change during the 25-year lifetime of the wind turbines, what would be the cost to the community of the electricity supplied by the WFEP over 25 years? Express your answer in dollars/kWh.