What is the relationship between individual freedom and responsibility to society

Answers

Answer 1

Answer:

i don't know the question sorry


Related Questions

What does the poem The Hill We Climb Address?

Answers

It is a powerful call to action focusing on themes of hope, unity, healing, and resilience. You learn how to reflect on these themes and consider how their own unique experiences and voices can help America “forge a union with purpose.”

Which sediment would have the slowest rate of deposition?
a round sediment
a very large sediment
an irregularly shaped sediment
O a high-density sediment

Answers

Answer:

It would be Irregularly Shaped Sediment Mi amigo

Explanation:

The sediment that would have the slowest rate of deposition would be: an irregular shaped sediment.

What are Sediments?

Sediments are strong materials that settles at the bottom of a fluid. This can also be seen as a natural material that is broken down into pieces and transported by the action of wind or water.

An irregular shaped sediment would therefore have the slowest rate of position because of its shape.

Learn more about Sediments here:

https://brainly.com/question/13291293

Can someone please write another paragraph on why students should NOT do standardized test?​

Answers

Answer:

Students should not complete standardized test because it does not truly evaluate what a student knows. The test is there simply to give the teacher an idea of what the student has learned so far. There is no reason to test a child to see what he or she is capable of. The test does not only put stress on the students but it also makes them have a different perspective of themselves. Yes standardized test is a form of testing a student's abilities, but not all student's do well under the pressure of knowing that they may or may not pass the Standardized test. And it places the students in a stressful situation, which can cause the student to fail the test.

Explanation:

The controversy could continue forever, however, there are many valid points on why students should not do standardized tests. First, standardized tests can cause an amount of anxiety and pressure toward children, which could reflect on their testing. Next, standardized testing can only cover so much material learned by kids throughout the year, and remembering every possible lesson taught could be nearly impossible, especially to the younger kids. Lastly, standardized testing could be an enormous amount of weight on teachers, pushing them to teach in a way the students will perform widely.

2
Which of the following indicates a sudden change in the mood of the story?
OA.
Avi stood on the edge of the hole and tried not to let the oil lamp.
ОВ.
"As he looked at his wrist to figure out the time, he discovered
OC.
"He tried his best to guard the lamp from the wind and took long..."
11
OD.
"Vines with white flowers seemed to swirl into the ground creating .

Answers

Answer:

I say OB because of the transitional word discovered. Something big happens that changes the mood to a sense of urgency.

Explanation:

does someone know the answer?

The word part micro comes from a Greek word that means "small."

Based on this information, what does the word microorganism mean as it is used in the passage?

"Biomass is organic material made from plants and animals (microorganisms)." (paragraph 1)

A. a young and growing life form
B. a rare and delicate life form
C. a life form that moves quickly
D. a life form too tiny to be seen​

Answers

Answer:

D. a life form too tiny to be seen

Explanation:

I believe d is your answer

Look at the underlined details in
the passage. What is a
"passthought"?
A passthought is an idea that is not
easily remembered.
A passthought is a mental image used
to unlock a device.
A passthought is a device that does
not need a password.
A passthought is a birthday message
sent to a friend

Answers

Answer:

A passthought is a mental image used

to unlock a device.

Explanation:

I hope its correct

Answer:

A passthought is a mental image used

to unlock a device.

Explanation:

in the story it said that character thought about his password so it opened.

Write an essay
stating your opinion
on whether success
is dependent on
having goals.

I DONT NEED A WHOLE ESSAY!! But I need to brainstorm 2 specific examples that prove the argument.

Answers

yes it is because goals give you something to live up to.

Your sick grandmother was admitted to the hospital. Write a letter to your brother describing the state of her health when you visited her

Answers

Answer: Here is a brief summary of what I have provided. I’d advise not to copy word for word if that was what you were going to do, it would be otherwise known as plagiarism, so get some information or data from this picture, not copy the full piece. Thanks!

Explanation: Hope this helps! Have a awesome day! <3

Narrative paragraph
“The Most Frightening Moment in My Life”
120-150 words

Answers

Answer:

This question requires a personal answer. Anyway, I will give you answer you can use as an example and modify it as you wish.

Explanation:

 I'm going to tell you how the most terrifying day of my life was.

I was 5 years old and I was going to my grandmother's house with my mother. It was 11 at night and everything was very dark. As we walked we could hear the dogs howling and worst of all, it was a very windy night.

The trees were moving with great force and the wind made noise when blowing. And suddenly, shortly before reaching my grandmother's house, a cat comes out of the trees and runs across my legs. I will never forget the shock I felt that night.

A narrative paragraph is one that tells a situation. It is usually a successive enumeration of facts, usually arranged chronologically.

Read the example below, and answer the question that follows.

Jonathan finished painting the ceiling.

How would you classify the underlined portion?

independent clause
adjectival phrase
verb phrase
simple sentence

Answers

Answer:

verb phrase?

Explanation:

painting is an action word and 'painting the ceiling' is a phrase.

Verb phrase is correct

Who has read Miss Peregrines home for children??

Answers

Answer:   My teacher has the book. Is it good?

Explanation:

Answer:

I have, a while (like 3 years lol) ago

Explanation:

Throughout history, freedom came at a high cost. Select all of the nouns

Answers

Answer:

history

cost

Explanation:

cost can be either noun or verb so it's a little confusing

water lost from the leaves enters the atmosphere.
Describe how water is recycled from the atmosphere back to the roots.​

Answers

Answer:

Another important “loop” in the water cycle involves condensation of water vapor in the atmosphere to form rain, soaking of the rain into the ground, uptake of the water by plant roots, and return of that water, in the form of water vapor, back into the atmosphere by transpiration through the leaves of the plants.

Explanation:

I dont know what I'm saying :)

If he (keep)..... on forgetting it, the teacher will punish him​

Answers

Answer:

If he keeps on forgetting it, the teacher will punish him​.

Explanation:

Conditional sentences are characterized as the sentences that display a condition or hypothetical situation followed by its associated outcome. Such sentences consist of a dependent(if) clause which expresses the condition and an independent clause to show the consequence.

As per the rules of the conditional sentences, if the consequential clause is written in future simple, the conditional clause would be written in present simple.

'If + present simple(V1 + s/es); main clause + future simple(will/shall + V1).'

Thus, the correct verb form to fill the given sentence would be 'keeps'(present simple) followed by future simple('will punish').

HELP PLEASE YEAH YEAH

Answers

Answer:

Parvana's opposite thoughts in the second paragraph is that she saw that her mother wasn't ready to give in yet.

The evidence that supports my answer is: "But that didn't mean she was ready to give in."

Explanation:

From the passage, it is revealed that when Parvana woke up, she saw that her mother looked much better. This shows that the discussion the mother was having with Mrs. Weera helped to brighten her up.

But Parvana discovered that despite her mother looking better, she wasn't ready to agree to what Mrs. Weera suggested.

The use of "But" in the evidence I highlighted after saying that her mother looked better shows the opposite thoughts of Parvana.

Who has seen the wind? Neither I nor you But when the leaves hang trembling, The wind is passing thro'; Who has seen the wind? Neither you nor I: But when the trees bow down their heads The wind is passing by. -Christina Rossetti, (Who has seen the wind?]​

Answers

Answer:

I am pretty sure it B.

i think it’s B i’m not sure

According to the text, how does a fixed mindset compare to a growth mindset?

A Students with either a fixed mindset or a growth mindset are equally discouraged by their mistakes.

B Students with either a fixed mindset or a growth mindset believe they can improve with hard work.

(Commonlit)
passage: Noticing mistakes boosts learning

C Students with a fixed mindset think their intelligence is set, while students with a growth mindset believe they can improve.

D Students with a fixed mindset focus on what they got wrong, while students with a growth mindset focus on what they got right.​

Answers

Answer:

C).  Students with a fixed mindset think their intelligence is set, while students with a growth mindset believe they can improve.

Explanation:

The key difference between a fixed mindset and a growth mindset is that the former consider their skills, talent, or intelligence as the static traits they are born with and are not subject to change. While the people with a growth mindset have a firm belief that they always have a probability to improve and grow in life by exploring and developing their inner skills or talent through determination and diligence. The different mindsets directly affect the learning pace and success of the students in life. The researches show that students with a growth mindset are more likely to achieve their goals as they possess an optimistic attitude to conquer their dreams and aspirations. Thus, option C is the correct answer.

Answer:

The answer is C

great backyard bird count

Answers

Wow that’s a lot of birds am I right

A small fable of around 70-90 words
It's fine if there are more or less words than that

Answers

Answer:

Hmm... I know a couple.

1. 'the boy who cried wolf'. You can find it by its name.

2. 'the apes and the two travelers'. You can find it by its name.

3. 'ice in the forest'. You can find it by searching up 'ice in the forest fable'.

In the great Gatsby Gatsby Daisy and Tom pursue the American dream identify one of the aforementioned characters dreams and why they wanted to consider with the characters day to pursue the dream and what character traits those actions reveal.

PLEASE HELP WITH A THESIS STATEMENT FOR DAISY AS TO WHY HER AMERICAN DREAM IS TO LIVE A LIFE FULL OF WEALTH AND GLAMOUR!!

I’LL MARK BRAINLIEST!!!

Answers

Daisy and Gatsby come from opposite ends of the class spectrum, and to Daisy, her reputation to the upper class is the most important thing. She is constantly looking for achievements to seem worthy of envy to her ‘friends’.

Daisy chose Tom because to her he represented a secure social position and the wealth she was accustomed to. Daisy believed that Tom could make her happy because he represented things that made her happy besides love, like material things and money. But Daisy can never be happy with Tom because when she married him, she objectified him into the things he gave her; the expectations of Tom that she constructs in her head are mostly made of the gifts she has received, rather than Tom’s actual personality and morals.

What is the meaning of "to curb his
sadness" as used in the 4th stanza?

Answers

Answer:

If you curb an emotion or your behavior, you keep it under control.

Explanation:

Answer:

I agree with the answer above ^^^^

When you are borrowing lines from an author is it okay to copy everything for as long as you cite the name of the author and the date?​

Answers

you cite the author and the page number i believe

You are joining the Science Fair and your teacher asked you to present your
proposal for your investigative project (IP). She told you to present the procedure
of your IP. What graphic organizer should you use? Explain briefly.

Answers

Answer:

Flowchart.

Explanation:

A flowchart can be defined as a graphical representation (graphic organizer) of an algorithm for a process or workflow.

Basically, a flowchart makes use of standard symbols such as arrows, rectangle, diamond and an oval to graphically represent the procedures (steps) associated with a system, process or workflow sequentially i.e from the beginning (start) to the end (finish).

In this scenario, your teacher asked you to present your proposal for your investigative project (IP) and the procedure of your IP. Thus, the graphic organizer you should use is a flowchart because comprises of the procedures for a project or program.

what is the main idea of “To Sir, With Love”

Answers

Answer:

The main themes of To Sir, with Love are education and racial prejudice. While Braithwaite overcomes the obstacles in his path, a critical reader might view his approach as somewhat egocentric, considering social problems as solved if he is able to stop them from affecting him personally.

Explanation: Hope this helps, the other kid was rude by posting links that was not helpful at all!

Describe the valley of ashes using two direct text references

Answers

Describe the valley of ashes using two direct text references

How the school molded to become a globally competent individual?​

Answers

Answer:Globally competent students must have the knowledge and skills to:

Investigate the World. Global competence starts by being aware, curious, and interested in learning about the world and how it works. ...

Weigh Perspectives. ...

Communicate Ideas. ...

Take Action. ...

Apply Disciplinary and Interdisciplinary Expertise.

Explanation:

Select the three nouns After many years of war, peace finally came

Answers

Answer:

Years, war, peace.

Explanation:

To keep it simple, a noun is a person, place, or thing. These all fit into this catagory.

What would happen if humans never took risks?

Answers

Answer:

we wouldnt advance

Explanation:

Risking is like gambling, you lose something or gain something

What 2 writing elements does the argumentative body have that the informative body does not have?

Answers

Answer:

counterclaim and rebuttal

Explanation:

If the star was spinning before the collapse, then the black hole will spin, too. If the collapse is perfectly symmetric, a smooth black hole forms. On the other hand, even a slightly lopsided collapse leads to a lumpy black hole, with erratic gravitational effects. The gravity might be strong in some places and weak in others, and pull in different directions. However, a lumpy hole won't stay lumpy for long, because its own gravity will work to smooth it out. —A Black Hole Is NOT a Hole, Carolyn Cinami DeCristofano What information in the passage helps answer the question asked previously? Gravity smooths out even the lumpiest black hole. A symmetrical collapse forms a smooth hole. Erratic gravity pulls a black hole in different directions. A collapse can be symmetrical or lopsided.

Answers

The passage provides information about the spin of a black hole, the relationship between the type of collapse and the resulting black hole's properties, the erratic gravitational effects of a lumpy black hole.

The passage provides several pieces of information that help answer the question asked previously. Firstly, it explains that if a star was spinning before its collapse, the resulting black hole will also spin. This indicates that the spin of a black hole is influenced by the initial conditions of the star.

Secondly, the passage describes two different types of collapses: perfectly symmetric and slightly lopsided. A symmetrical collapse results in a smooth black hole, while a lopsided collapse leads to a lumpy black hole with erratic gravitational effects.

This information highlights the relationship between the nature of the collapse and the resulting black hole's properties.

Additionally, the passage states that a lumpy black hole experiences gravity that might be strong in some places and weak in others, pulling in different directions. This indicates that the gravitational effects of a lumpy black hole are not uniform and can vary across its surface.

Finally, the passage explains that a lumpy black hole will not remain lumpy for long, as its own gravity will work to smooth it out. This reveals that, over time, gravity plays a role in stabilizing and smoothing the surface of a black hole, even if it initially formed as a result of a lopsided collapse.

For more question on passage visit:

https://brainly.com/question/25950911

#SPJ11

Other Questions
A force of 20,000 N is exerted for 5.00 s, on a 75,000 kg mass. What is the impulse of the force for this 5.00 s ? Add a comma or semicolon if needed. Otherwise, submit the text without any additionalpunctuation.Keenan focuses his workouts on building strength and lean muscle mass _ to do so, heperforms a variety of exercises using the barbells and weight machines at the gym. the best answer it requests services, data and other resources available on the server What are the sins committed by Don Pedro and Don Diego against Don Juan? Radioactive decay occurs when the ____ decays Read the following sentence:Some kinds of water quality can be checked right in the stream or at the well.Which answer correctly uses domain-specific language to strengthen the writing? A)Some aspects of water quality can be determined directly in the stream or at the well.B)Some kinds of water quality can be figured out right in the stream or at the well.C)Some types of water quality can be tested right in the stream or at the well.D)Some aspects of water quality can be checked right in the stream or at the well. Please complete the following DNA strands1. AGGTCCAAGCTCAAATTTCCCC2. GAAACCCCTTAAACCTTAATTCC3. GCGCGCGCAAATTTTTCCCATCTPlease complete the following strands using RNA:1. AGGTCCCAAAGGCCCTTTCC2. UAAAGGGCCCAGCCCACC3. CUAAAAGGGGGUUUUAACC What is 1/12 cups converted into ounces? Match the countries and their aims after World War I.GermanyFranceItalyUnited Stateswanted to establish a lasting peace in Europewanted a treaty based on the armistice it had signedwanted territories near the Adriatic that Britain had earlier promisedwanted to punish and weaken Germany Plz, answer this question plz! Plz, answer this question plz! Plz, answer this question plz! Plz, answer this question plz! Plz, answer this question plz! I need help with these two questions Bob ate 1/3 loaf of bread over 4 days. He ate the same amount of bread each day. What fraction of the loaf did Bob eat each day? danielle did not complete 15 of her 200 assignments last year. Kim said that is 0.075 of her assignments and Kelly said it is 0.75 of her assignments. Who is correct and how do you know? A ___________ is a large volcano built up of alternating layers of lava and ash, or cinders.a.stratovolcanoc.cinder coneb.shieldd.stratus volcanoPlease select the best answer from the choices providedBRAINLYIST PROVIDED I NEED HELP GUYSDid the French Revolution achieve its goals? Why ? Or why not? the cost of lunch l after a 15% tip can be represented by the expression l + 0.15l. Simplify the expression. Then determine the total cost of the lunch after the lunch bill is $10. Please somebody answer fast I really need this answer Leading up to the signing of a contract with an integration clause, a buyer sent an e-mail to the seller of a beautiful, new $45,000 boat asking, "You provide financing, right?" The seller responded, "Yes, of course." The contract, which the parties signed yesterday, said nothing about financing. Right after signing, the seller said, "OK, let's get you set up with financing!" He then ran the buyer's credit, which was not good. The buyer was not approved for financing through the seller's only source. The buyer believes that he, therefore, is not liable for the cost of the boat. Is the buyer correct? Work out the length x.17 cm9 cm Here is an expression 3*2t. Evaluate the expression when t is 1