I NEED THIS ASAP
Which indicates what happens to the kinetic energy when the mass of a moving object increases?
A. The kinetic energy does not change
B. The kinetic energy increases by the same factor as the mass increase
C. The kinetic energy increases by the square of the same factor as the mass increase
D. The kinetic energy decreases by the same factor as the mass increase
Answer:
C. The kinetic energy increases by the square of the same factor as the mass increase
Explanation:
As the object moves faster, potential energy goes down and kinetic energy increases.
Approximately time passes between B and F
Answer:
14 days
Explanation:
It takes 27 days for the moon to make a full rotation around the earth. Because half the of the rotation around the earth has been made, half 27. Half of 27 is 13.5, so the time between B and F is approximately 14 days.
What factors do you need to know in order to calculate a region's population growth
A bee gets nectar from a flower and the flower gets help with pollination. Both benefit, so the symbiotic relationship is _______________.
Competition
Commensalism
Mutualism
Parasitism
Table 1. Representative Animals and their Organs of the Digestive System
Selected Organ/s
Description/s
of the Digestive
System
Organisms
Name of
Representati
amoeba
1.
1.
2.
2.
planaria
1.
2.
1.
2.
Answer:
zucydrwesrdfdshwhra avdtc
Which option describes the function of RNA polymerase?
Select one:
Carrying amino acids to the transcription site.
Moving mRNA strands into and out of the nucleus.
Splitting the DNA double strand into two single strands.
Forming an RNA strand using a DNA strand as a template.
Answer:
brown
Explanation:
have you pooped today?
The option which describes the function of RNA polymerase is that it forms an RNA strand using a DNA strand as a template. Thus, the correct option for this question is D.
What is RNA polymerase?RNA polymerase may be defined as a multi-unit enzyme that synthesizes RNA molecules from a template of DNA through a process called transcription. This enzyme is responsible for copying a DNA sequence into an RNA sequence, during the process of transcription.
RNA polymerase binds to DNA, separates the strands, then uses one of the strands as a template from which to assemble nucleotides into a complementary RNA strand.
It uses a single-stranded DNA template to synthesize a complementary strand of RNA. Specifically, RNA polymerase builds an RNA strand in the 5' to 3' direction, adding each new nucleotide to the 3' end of the strand.
Therefore, the option which describes the function of RNA polymerase is that it forms an RNA strand using a DNA strand as a template. Thus, the correct option for this question is D.
To learn more about RNA polymerase, refer to the link:
https://brainly.com/question/15872478
#SPJ2
When a squirrel hears a strange noise that might indicate the presence of a predator, fight-or-flight hormones are released into its system. The hormones help prepare the squirrel's body to do strenuous physical activities, like quickly climbing up a tree, more efficiently. Which statement describes how two organ systems work together to help a squirrel respond to a possible external threat?
Answer:
The flight-or-flight hormones are released by the endocrine system in response to environmental changes detected by the nervous system.
Explanation:
yes
A. Producer
B. Primary consumer
C. Secondary consumer
D. Tertiary consumer
Answer:B. Primary consumer
Explanation:The reason why Its b because that primary comsumers are mostly herbivores or the primary comsumer is the first consumer to eat the producer.Hope it helps!
How does carbon dioxide and
water enter the plant?
Answer:
CO2 through the leafs and H2O through the roots
Explanation:
CO2 enters through the stomata and the water gets into the plant through the roots and goes up the plant through capillary action.
Answer:
co² enters the plant by stomata where as the water enters through roots when we watered the plant
The cactus has a specialized fleshy stem that is specialized to store water for long periods of time. Which plant tissue most likely makes this action possible?
I know the answer is Ground, but i need to know WHY the answer is ground tissue. I WILL MARK BRAINLIEST
(on EDGE)
Answer:
If I were to guess its probably Vascular
Explanation:
Cactuses can store water nearly four months mainly in the winter and watering is not required for them frequently during that time. The stem acts as a reservoir for the amount of water it holds. The ground tissue of cactus has lots of parenchymal cells that store water.
What is parenchyma?The ground tissue system comes from a ground meristem which has three tissues, namely parenchyma, collenchyma, and sclerenchyma.
The ground tissue of cactus has many parenchyma cells that store water.
Thus, it can be concluded that the ground tissues helps cactus to store water for a long time.
For more details regarding ground tissue, visit:
https://brainly.com/question/346979
#SPJ2
Alex wants to know if a fossil he found was closely related to cats. some likely features of the fossil that can help him reach a conclus Check all that are true.
A. Bone Structure
B. Blood
C. Tissue
D. Skull Shape
Answer:
A and D
Explanation:
A fossil is made of bones and it's the dead version of the animal, therefore it has to be A and D as blood and tissue have already rotted away.
I hope this helps you!! ^-^
How could students find out whether a short ramp or a long ramp would require less force to use? Measure the amount of force it takes to move ----
Answer:
Explanation:
By using an object up two ramps. The objects best have the same height, yet they must have different lengths.
Of the phenomena that correlate with the data above, the one that is the most direct consequence of the trend in air travel is the increase in the spread of infectious diseases the increase in the spread of infectious diseases A the increase in urban sprawl the increase in urban sprawl B the decrease in biodiversity the decrease in biodiversity C the increase in hypoxic aquatic ecosystems the increase in hypoxic aquatic ecosystems D the decrease in the total fertility rate of developed nations
Answer: the increase in the spread of infections diseases
Explanation:
got it right
The increase in the spread of infectious diseases are the most direct consequence of the trend in air travel. So, the correct option is A.
What are Infectious diseases?Infectious diseases are defined as disorders that are caused by organisms such as bacteria, viruses, fungi or parasites. Many organisms live in and on our bodies which are generally harmless or even helpful but some organisms can cause disease. Some infectious diseases can spread from person to person.
Infectious diseases can be viral, bacterial, parasitic or fungal infections a rare group of infectious diseases known as transmissible spongiform encephalopathy (TSE). The increase in the spread of infectious diseases are the most direct consequence of the trend in air travel.
Therefore, the correct option is A.
Learn more about Infectious diseases, here:
https://brainly.com/question/11478894
#SPJ6
Your question is incomplete, most probably the complete question is:
Of the phenomena that correlate with the data above, the one that is the most direct consequence of the trend in air travel?
A. the increase in the spread of infectious diseases
B. The increase in urban sprawl
C. the decrease in biodiversity
D. the increase in hypoxic aquatic ecosystems
E. the decrease in the total fertility rate of developed nations
Seventy percent of the plants containing chemicals useful for cancer treatment are found only in rain forests. What type of ecosystem service do these plants provide ?
Answer: The type of ecosystem service these plants provide is PROVISIONING SERVICES.
Explanation:
Ecosystem services is defined as the activities that occurs in an ecosystem which directly or indirectly enhance the well being of humans. They are grouped into four different categories which include:
--> Regulating services
--> cultural services
--> supporting services and
--> provisioning services
The PROVISIONING SERVICES obtained from the ecosystem are any benefits or products that can be gotten from nature. These include:
--> food
--> drinking water
--> wood fuel
--> natural gas
--> medicinal resources (gotten from herbal plants which can be used to manufacture drugs for cancer treatments).
What is gold an example of?
Answer:
Money, Power, and Death
Explanation:
Answer:
nonrenewable resource
Please complete the following DNA strands
1. AGGTCCAAGCTCAAATTTCCCC
2. GAAACCCCTTAAACCTTAATTCC
3. GCGCGCGCAAATTTTTCCCATCT
Please complete the following strands using RNA:
1. AGGTCCCAAAGGCCCTTTCC
2. UAAAGGGCCCAGCCCACC
3. CUAAAAGGGGGUUUUAACC
A chewing insect damages the vascular tissue of a plant system. This damage will most directly affect the
Answer:
Conduction of water and minerals between the roots and leaves
Explanation:
- EIjiro
an energy-producing organelle found in nearly all cells of plants and animals.
Answer:
Mitochondria
Explanation:
Mitochondria is and energy kinda like a battery and cells have thousands of mitochondria. Hope this helps :)
Which group of characteristics describes the organism in the illustration below? Question 2 options: multicellular, endothermic, invertebrate single-celled, ectothermic, invertebrate multicellular, endothermic, vertebrate multicellular, ectothermic, vertebrate
Answer:
It is multicellular,ectothermic,vertebrate
Explanation:
I took the quiz on it
Hanan ate a meal that consisted of rice, dal, fish and fried potatoes. Explain the process of digestion of the food with reference to the parts and enzymes involved in the digestive system.
Answer: A digestive system can be defined as a system which is made up of the alimentary canal and the associated glands and organs which produce some of the enzyme- rich secretions that bring about digestion. The process of digestion of food Hanan are, is discussed below.
Explanation:
The food taken by Hanan consist of carbohydrates (rice, potatoes ), protein( fish, dal) , fats and oil( fish, fried potatoes). The digestion of the food taken passess through a long tube ( alimentary canal) which stretches from the mouth through oesophagus to stomach, intestines and down to the anus.
In the MOUTH, the following occurs:
--> The food is cut and grinded into smaller pieces by the help of the teeth.
--> the enzyme ptyalin acts on the carbohydrate part of the food converting it to complex sugar.
--> the food is mixed with saliva, with the help of the tongue, is rolled into a bolus which is then swallowed.
At the STOMACH, food enters through the peristaltic movements of the oesophagus, The following occurs:
--> The muscular walls of the stomach contract and relax forcefully, thus churning the food.
--> Gastric juice( consists of pepsin, renin and dilute hydrochloric acid). Dilute hydrochloric acid activates pepsinogen to pepsin which digests proteins to polypeptides.
--> Food remains in the stomach for three to four hours. By this time, it is a thick, creamy fluid called chyme which them moves to the duodenum (small intestine).
At the SMALL INTESTINE, digestion occurs at the first part called the duodenum, and later part called the ILEUM.
--> Several substances are secreted into the duodenum from the pancreas( pancreatic juice) and liver( bile), the accessory organs of digestion.
--> pancreatic juice contains three important enzymes whose activities include:
• Amylopsin: Breaks down complex sugar to maltose
• Trypsin: breaks down protein into peptides
• Lipase: Breaks down fat into carboxylic acids and glycerol (end product of digestion of fat).
--> Bile from the liver, adds water to the chyme, emulsifies fat and neutralise the action of dilute hydrochloric.
At the ILEUM, intestinal juice is produced by special cells of the small intestine. Their actions include:
• maltase: this acts on maltose converting it to glucose( which is the end product of carbohydrate digestion).
• erepsin: This acts on peptides converting it to amino acids( which is the end product of protein digestion).
Absorption takes place at the small intestine.
ASAP due today
Explain one challenge we face using nuclear energy.
Answer:
The major challenges facing the nuclear industry include ensuring power plant safety, protecting reactors from natural disasters and external aggression, and finding effective solutions for long-term waste management.
Explanation:
Answer:
The major challenges facing the nuclear industry include ensuring power plant safety, protecting reactors from natural disasters and external aggression, and finding effective solutions for long-term waste management.
Have a nice day!
Calcium is a substance found in vitamins that people take to help strengthen their bones and teeth.
Which plant has been used for a similar purpose?
Answer:
B.) Horsetails!
Explanation: I got it right on the quiz! Good luck!
Answer: horsetails
Explanation: js trust me
The current genetic code evolved Please choose the correct answer from the following choices, and then select the submit answer button. Answer choices before the common ancestor of all extant life. after the common ancestor of all extant life but before eukaryotes split from the other domains of life. after eukaryotes split from other domains of life but before the split of multicellular animals and multicellular plants. after the split of multicellular animals and multicellular plants but before the common ancestor of chordates. after the common ancestor of chordates.
Answer:
before the common ancestor of all extant life.
Explanation:
Genetics can be defined as the scientific study of hereditary in living organisms such as humans, animals and plants.
Heredity refers to the transfer of traits (specific characteristics) from the parent of a living organism to her offspring through sexual reproduction or asexual production. Some examples of hereditary traits are dimples, tongue rolling, baldness, handedness, freckles, curly hair, color blindness, height, etc.
Basically, deoxyribonucleic acid (DNA) is an organic complex-molecular structure found in all living organisms. It comprises of genes and is essentially the foundation block of all living organisms such as humans, animals and plants.
The current genetic code evolved before the common ancestor of all extant life i.e that are still in existence or alive.
Identify one food chain in this ecosystem.
Answer:
Sun -> Grass -> Beetle -> Blue Jay
Sun, Grass, Worms, Woodpecker
Explain why it is still an evolutionary advantage to produce flowers in
plants.
Answer:
Those specialized flowers are able to attract organisms to help pollinate and distribute seeds. Another cool advantage is the fruit/seed packaging.
I generally remain in the nucleus what am I DNA, RNA, or both?
Answer:
DNA
Explanation:
What is an antibiotic? Which class of antibiotics works best for Bordetella pertussis?
You can download answer here
tinyurl.com/wpazsebu
Please help, I’ll give brainliest :)
Answer:
a,b and c
Explanation:
( it might be wrong pls dont report me just let me kno y its wrong )
Help!!! please!! this test is timed!! I will give brainliest!!!
What is a system?
2 points
The solid rock part of Earth, including mountains, valleys, continents, and all of the rock beneath the oceans
The set of all water on the earth's surface, such as lakes, seas, and oceans
A group of related parts that all work together to perform a specific function
The greenhouse gases that help keep the earth at a temperature where water is in liquid form
Answer:
A group of related parts that all work together to perform a specific function
Explanation:
Could somebody please help me?
Select the correct answer
How many pathways are depicted in the image of the carbon cycle?
A) one
B) two
C) three
D) four
Thank you! :)
Answer:
4
Explanation:
Answer:
4
Explanation:
Plato user