Answer:
Organelles are specialized structures that perform various jobs inside cells. The term literally means “little organs.” In the same way organs, such as the heart, liver, stomach, and kidneys, serve specific functions to keep an organism alive, organelles serve specific functions to keep a cell alive.
Explanation:
The external appearance of traits is called: -----
a.
Ecotype
b.
Genotype
c.
Cytotype
d.
Phenotype
Answer:
d) Phenotype
Explanation:
External appearance of an individual trait is called phenotype. The term "phenotype" refers to the observable physical properties of an organism; these include the organism's appearance, development, and behavior.
I’ll give BRAINLIST??What organs/organs systems does schizophrenia affect and how does it affect it?
Answer: Schizophrenia is considered a disorder of the mind, influencing the way a person thinks, feels and behaves.
Explanation: Physical health is also important because if it is compromised, many of the benefits of improved mental health will be offset. Compared with the general population, schizophrenia patients are at increased risk of weight gain, abdominal obesity, diabetes, metabolic syndrome, and cardiovascular disease.
Answer:
Schizophrenia involves a range of problems with thinking (cognition), behavior and emotions. Signs and symptoms may vary, but usually involve delusions, hallucinations or disorganized speech, and reflect an impaired ability to function. Symptoms may include: Delusions.Schizophrenia is associated with changes in the structure and functioning of a number of key brain systems
Explanation:
Have a great day!
similarities between the computer and the human body.
Answer:
Both of them have memory, both of them use electrical signals, both of them can retrieve and transmit data, both of them have partitions and both of them connect data in order to reach to conclusions which are logical and working
Explanation:
Your skeleton enables you to move.
True
False
Answer:
True
Explanation:
Your skeleton supports your body weight to help you stand and move. Joints, connective tissue and muscles work together to make your body parts mobile.
Answer:
Allows movement: Your skeleton supports your body weight to help you stand and move. Joints, connective tissue and muscles work together to make your body parts mobile.
Explanation:
please mark my answer in brainlist
A dowry is:
A.
Money or property given by a man to or for his bride
B.
A gift given by the bride to her mother-in-law
C.
Money or property given by a man to his parents
D.
Money or property given by the bride to her parents
Answer:
B
Explanation:
As dowry system is the social problem in which the bride/bride's family has to give money or property to the groom's family.
The bride/bride's family has to give money or property to the groom/groom's family on their marriage.
The population of mice in a local forest ecosystem has recently died out due to disease. In the past, these mice made up a large part of the diet of the forest fox.
What is the best prediction about what will happen to the foxes?
Fill in the blanks below with the correct word to complete the sentence.
Water is warmed by the sun and
It is then cooled and
Finally, it is brought back to Earth in the form of
Answer:
Evaporates, Condensed, Liquid Water
Explanation:
Water is warmed by the sun and evaporates
It is then cooled and condensed
Finally, it is brought back to Earth in the form of Liquid Water
Answer:
Fill in the blanks below with the correct word to complete the sentence.
Water is warmed by the sun and evaporate
.
It is then cooled and condensation
.
Finally, it is brought back to Earth in the form of
Water
⇒ precipitation.
Explanation:
got it right 9/23/22
A recombinant plasmid molecule is introduced into a bacterial cell by A. recombination B. nuclear transplantation C. ligation D. transformation
Which of the following is NOT considered a form of precipitation? *
Rain
Snow
Lightning
Hail
All of the above are considered precipitation
Answer:
Lightning is not considered a form of precipitation but rather a discharge of electricity.
1. Which of the following characteristics is possessed by invertebrates?
a) exoskeleton
b) endoskeleton
c) joint appendages
d) cephalization
Answer: a) exoskeleton
Explanation:
Well, many invertebrates – and all arthropods – have a protective external casing called an exoskeleton. This literally means ‘outside skeleton’ and its role is to cover the animal’s soft tissues and also provide a rigid structure to which the creature’s muscles can attach.
What is the main function of nucleic acids?
A. provide genetic information
B. long term energy
C. short term energy
D. build muscle, hair, and nails
Fraternal twins, while conceived at the same time, are not genetically identical.
Which statement best explains why these siblings are genetically different from each other?
A.One chromosome from each pair randomly passes to the sex cells during meiosis and leads to differences between the siblings.
B.One chromosome from each pair randomly passes to the sex cells during fertilization and leads to differences between the siblings.
C.Mutations occur during meiosis and lead to differences between the siblings.
D.Mutations occur during fertilization and lead to differences between the siblings.
Fraternal twins are not genetically identical because one chromosome from each pair randomly passes during meiosis and leads to differences between the siblings. Meiosis involves independent segregation of sex chromosomes.
Meiosis is a type of reductional cell division by which a parent cell produces four daughter (gametes) cells having half the genetic material.
Fraternal twins occur when two egg cells are released by the mother, which are fertilized by a different sperm.
During meiosis, sex chromosomes are separated and segregate in a random manner in daughter (sex) cells.
Learn more in:
https://brainly.com/question/7002092
b) Give an example of an animal with radial symmetry and an example of an animal with bilateral
symmetry. (2 points)
Answer:jellyfishes, corals, anemones, and ctenophora.
Explanation:
Examples of animals that possess bilateral symmetry are: flatworms, common worms ("ribbon worms"), clams, snails, octopuses, crustaceans, insects, spiders, brachiopods, sea stars, sea urchins, and vertebrates.
What is a long chain of one-ring sugar molecules?
Answer:
polysaccharide
Explanation:
need help with the top question :p
PLS HELP, HELP HHHHEEEELLLLPPPP
1) How long is it's growing season for carrots.
2) How long is it's growing season for corn.
Answer:
2-4 months for carrots and about 120 days for corn
Explanation:
Define bottleneck effect.
Koyi hai? ✌️
Answer:
When disaster strikes, an ecosystem can change very quickly. When an event causes a drastic decrease in a population, it can cause a type of genetic drift called a bottleneck effect.Hope this helps ~Answer:
The bottleneck effect is an extreme example of genetic drift that happens when the size of a population is severely reduced. Events like natural disasters (earthquakes, floods, fires) can decimate a population, killing most individuals and leaving behind a small, random assortment of survivors.
Which renewable resource is not safe for the environment and why?
Answer: Biomass
Biomass produces gas or many sorts of waste products which are mostly used in burning and cooking. It is plant or animal material used as fuel to produce electricity or heat. Examples are wood, energy crops, and waste from forests, yards, or farms.
But the reason why it can be harmful is because biomass can produce gases like methane. Methane is a greenhouse gas which can harm the environment and reduce the ozone layer that stops harmful UV light from reaching the earth atmosphere.
what is colustrum? explain plz
This is confusing, help please
Answer:
C: the song bird
Explanation:
Birds follow a type II or in your case a type B survivorship curve. Unlike elephants which are a Type I or Type A, and the bugs are Type III or Type C in your case.
Answer: I think it would be (C)
Explanation:
I really hope this helps
current definition
please help
Answer: now or like presently
Explanation:
I dont know
thrips are insects that feed on rose
Answer:
????????????????????????
what is the effect of atmospheric disturbances on stars
This the correct answer
Explanation:
However,when light enters the Earth's atmosphere,the different wind speeds distort the light waves,leading to distortions in the image of stars.The effects of the atmosphere can be modeled as rotating cells of air moving trubulently.
#carryonlearning
#brainlyeveryday
#ctto
What is the name of the disease caused by a lack of thyroid hormones?
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
Answer:
look at explanation
Explanation:
basically in order to go from mrna to trna just replace
a becomes u
g becomes c
u becomes a
c becomes g
What is limestone?**
Answer: a hard sedimentary rock, composed mainly of calcium carbonate or dolomite, used as building material and in the making of cement.
How does natural selection change the frequency of genes or traits over many generations? Biology students conducted an experiment mimicking genetic variation and coloration. Students used different colored beans to represent animals that might be prey: mice, for example. A student in each group was the predator: a hawk. Beans (mice) were randomly scattered on multicolored floor tiles, each color within four tiles. The hawk collected mice (beans) for 10 seconds. Mice not eaten reproduced. Three generations of data a shown in the table.
Genetic variation helps to drive natural selection and potentially, evolution. Red, white, and striped beans (mice) represent offspring that are the product of meiosis and sexual reproduction. Black and speckled beans (mice) are the result of mutations. Using the student data analyze the effects of these mutations on natural selection.
A) The color mutations provided a survival advantage to these two populations of mice.
B) The advantage of the mutations is dependent on the environment and external conditions.
C) While mutations provide genetic variation they did not play a role in natural selection.
D) The speckled mutation provided an advantage while the black mutation was a disadvantage for survival.
Answer:
D) The speckled mutation provided an advantage while the black mutation was a disadvantage for survival.
The speckled mutation provided an advantage while the black mutation was a disadvantage for survival.
Natural selection refers to the observation that organisms that are more suited and adapted to their environment live long enough to survive and reproduce thereby passing on their favorable characteristics to their offspring.
The mutation in which the mice became speckled was shown to be an advantage from the table. Hence, the speckled mutation provided an advantage while the black mutation was a disadvantage for survival.
Learn more about natural selection: https://brainly.com/question/2725702
If a firm hires 10 workers at $9 per hour each and the 11th worker will be hired only if the wage rate falls to $8 per hour, the marginal wage rate must be _____.
Multiple Choice
−$2
$2
−$2.20
$2.20
Answer:
-2 USD
Explanation:
In which part of the male reproductive part do pollens found? A. Anther B. Filament C. Stigma D. Style
Answer:
Anther
Explanation:
Stamen is a male reproductive part in which anther produce male reproductive cells.
Answer:
The stamen is made up of two parts: the anther and filament. The anther produces pollen (male reproductive cells). The filament holds the anther up. During the process of fertilization, pollen lands on the stigma, a tube grows down the style and enters the ovary.
Explanation:
Show you work here using the data table 1 to calculate the energy consumed by this female sea otter.
Answer:
the female sea otter has 1
Explanation: