after the outbreak of a mysterious disease, the average wait time at a hospital by 70%. Before the outbreak, the average wait time at a hospital is m minutes

Answers

Answer 1

Answer:

1.7m

Step-by-step explanation:

Given that 'm' was the waiting time before the outbreak

After the outbreak, waiting time increased by 70%.

This implies that :

70% of m increase

m + 70% of m

m + 70/100 of m

m + ( 70÷100 ) × m

m + 0.7m

= 1.7m

Step-by-step explanation:


Related Questions

29. Martin has some dollar notes. 20% of the notes are $10 notes, 40% of
the remainder are $5 notes and the rest are $2 notes. He has a total
of $1026. How many notes does Martin have altogether?

Answers

Answer:

225 notes

Step-by-step explanation:

Let the number of notes is x.

20% of notes is:

0.2x

40% of the remainder is:

40% of 0.8x, so it is 0.8x*0.4 = 0.32x

Remaining notes are:

x - 0.2x - 0.32x = 0.48x

Total of the notes:

0.2x*10 + 0.32x*5 + 0.48x*2 = 10262x + 1.6x + 0.96x = 10264.56x = 1026x = 1026/4.56x = 225

if l||m, find the value of x.

Answers

l || mWhen two parallel lines are intersect by a transversal, then the corresponding angles are equal.[tex]11x - 47 = 6x - 2 \\ = > 11x - 6x = - 2 + 47 \\ = > 5x = 45 \\ = > x = 9[/tex]

Answer:

9

Hope you could get an idea from here.

Doubt clarification - use comment section.

Answer:

Step-by-step explanation:

11x - 47 = 6x - 2                  Corresponding angle. Add 47 to both sides

11x = 6x + 47 - 2                 Combine

11x = 6x + 45                      Subtract 6x from both sides

11x - 6x = 45                       Combine

5x = 45                              Divide by 5

5x/5 = 45/5

x = 9

PLEASE NO LINKS AND NO NEGATIVITY

Answers

Step-by-step explanation:

Answer is student 1 and 3 ( the second option is correct )

Answer:

The answer is Student 1 and 3.

Step 1: Break down each multiple-choice.

Student 1: -(5r-3s+1)

Given the distributive law of multiplication, -, which is also known as -1, should be multiplied by every other term in the expression, which gives us -5r+3s-1

Student 2: -5r+3s+1 (given)

Student 3: -5r+3s-1

The values of Student 1 and 3 are the same, thus the answer is Student 1 and 3.

The extended warranty on a $885 washer is 15% of the purchase price and lasts for five years. What is the effective cost per year of the extended warranty?
(use a dollar sign and 2 decimal places)

Answers

Answer:

8.85

Step-by-step explanation:

Your class is learning to tie knots. Each student needs a piece of rope that is 3/6 yard long how many yards of rope are needed for the 16 students in your class.

Answers

Answer:The class will need 8 yards.Step-by-step explanation:1 student = 3/6 rope=> 16 students = 3/6 x 16=> 48/6 = 16 students=> 8 yards = 16 students.Conclusion:

Therefore, the class will need 8 yards.

Hoped this helped.

[tex]-BrainiacUser1357-[/tex]

PLS HELP WILL GIVE BRAINLYEST

Answers

131° is the right answer

Step-by-step explanation:

the supplementary angle to 139° (left of that angle, still under the red l line) is 180 - 139 = 41°.

therefore,

A = 180 - 90 - 41 = 49°.

B is the supplementary angle to A.

B = 180 - 49 = 131°

remember, the sum of all angles around one point on one side of a line is 180° (that is called supplementary angles).

and the sum of all angles in a triangle is always 180° too.

WILL GIVE BRAINLIEST HELP ASAP

Answers

Step-by-step explanation:

I cannot draw here, but I can show and tell you how to find 2 points of the individual lines that you can then mark on the chart and draw the line through them.

1)

y = 7/2 x - 2

so, the first and easiest point is the y-intercept (where x = 0).

x = 0, therefore, y = -2

so, the first point is (0, -2)

for the second point : what value of x would eliminate the fraction and make this whole integer number calculations ?

well, x = 2 !

so,

y = 7/2 × 2 - 2 = 7 - 2 = 5

and our second point is (2, 5)

2)

y = -6x + 3

the same principles. first x = 0, therefore y = 3

the first point is (0, 3)

for the second point we can choose any integer x, as all the other terms are integer too.

let's pick x = 1

y = -6×1 + 3 = -6 + 3 = -3

so, the second point is (1, -3)

3)

y = -5

this just means that for every possible value of x the resulting y value is -5.

that means it is a horizontal line through y = -5 or (0, -5)

4)

y = 6/5 x + 1

the same principles. x = 0, therefore y = 1

the first point is (0, 1)

for the second point, again, what x eliminates the fraction and makes all an integer operation ?

well, x = 5.

y = 6/5 × 5 + 1 = 6 + 1 = 7

ok, 7 is off the chart, so let's use x = -5 instead.

y = 6/5 × -5 + 1 = -6 + 1 = -5

so, the second point on the chart is (-5, -5)

I need help with this

Answers

Answer:

X represents The value of players on the field

Step-by-step explanation:

the numbers 0-11 are showing how many people would be on the field should an official game be played

Someone plz help :(

Side Lengths Angle Measures

6.6 in. 45∘

9.4 in. 90∘

6.6 in. 45∘

Based on the measurements, which answer best describes the triangle?

obtuse scalene triangle

obtuse isosceles triangle

acute scalene triangle

right isosceles triangle

right scalene triangle

right equilateral triangle

acute isosceles triangle

Answers

[tex]\huge \bf༆ Answer ༄[/tex]

According to the given information, The Triangle should be ~

[tex] \sf Right \: \: Isosceles \: \: triangle [/tex]

It's because the Triangle has two equal sides 6.6 inches each. and One right angle (90°) ~

1 half times 2 / 6 times six plus four​

Answers

[tex] \bold{answer \: \: \to} \\ 1\frac{1}{2} \times \frac{2}{6} \times \frac{6}{1} + 4 = \\ = \frac{3}{2} \times \frac{1}{3} \times \frac{6}{1} + 4 \\ = \frac{3}{6} \times \frac{6}{1} + 4 \\ \ = \frac{18}{6} + 4 \\ = 3 + 4 \\ = \boxed{ \bold{7}}[/tex]

There is a string of red and blue lights strung around
a window. The red lights blink every 3 seconds, and
the blue lights blink every 5
seconds. How many
times will they blink at the same time in one
minutes?

Answers

Answer:

4 times because they will have the common number of 15 and since there is 60 seconds in a minute you would divide 60 by 15, and that equals 4

Step-by-step explanation:

What is the slope of the line

Answers

The slope of the line is 2

The formula for finding slope using two coordinate pairs is y-y
——-
x-x
In this case, the y values are 10 and 2, and the x values are 6 and 2. If we plug these into our formula the equation is 10-2
———
6-2
10-2 is 8 and 6-2 is 4. So 8 divided by 4 would equal 2

Help!!! need the answer asap
Only question 6 please!!

Answers

Answer: D) additive inverse

Explanation:

The concept of the additive inverse is that we add some number x, with its opposite -x, to get 0. The two items cancel each other out.

[tex]x + (-x) = 0\\ \text{or}\\-x+x = 0[/tex]

In this case, [tex]x = \sqrt{3}[/tex]

The following circular spinner has 10 sections of equal size. If the spinner is spun twice, what is the probability that the spinner lands on an odd number both times?

Answers

Answer:

The chance of anding on A for one spin is 90+45360=38. So the probability of that happening twice in a row is 38×38=964.

Step-by-step explanation:

hope this helps you mark me brinilylist

Carmen is given a parallelogram and is trying to prove that the opposite angles of a parallelogram are congruent. She draws a parallelogram and a diagonal as shown.Along with the definition of a parallelogram, which pair of reasons can Carmen use for her proof?

Answers

Angles theorem and Reflexive property of congurence

The solution is

Each diagonal of a parallelogram separates it into two congruent triangles

So , ΔABC ≅ ΔCDA

Opposite angles are congruent

So , ∠B ≅ ∠D

What is a Parallelogram?

A parallelogram is a simple quadrilateral with two pairs of parallel sides. The opposite or facing sides of a parallelogram are of equal length and the opposite angles of a parallelogram are of equal measure

The four types are parallelograms, squares, rectangles, and rhombuses

Properties of Parallelogram

Opposite sides are parallel

Opposite sides are congruent

Opposite angles are congruent.

Same-Side interior angles (consecutive angles) are supplementary

Each diagonal of a parallelogram separates it into two congruent triangles

The diagonals of a parallelogram bisect each other

Given data ,

Let the parallelogram be ABCD

Now , AC is a diagonal of the parallelogram

According to the postulates of parallelogram

Opposite sides are parallel

Opposite sides are congruent

Opposite angles are congruent

Same-Side interior angles (consecutive angles) are supplementary

Each diagonal of a parallelogram separates it into two congruent triangles

The diagonals of a parallelogram bisect each other

And ,

From the figure , we can deduct that ΔABC ≅ ΔCDA by

Angle A is congruent to angle C, and angle D is congruent to angle B

So , from congruent triangle theorem ΔABC ≅ ΔCDA

And ,

∠B ≅ ∠D

Because Opposite angles are congruent of a parallelogram

Hence , Each diagonal of a parallelogram separates it into two congruent triangles

So , ΔABC ≅ ΔCDA

Opposite angles are congruent

So , ∠B ≅ ∠D

To learn more about parallelogram click :

https://brainly.com/question/23488153

#SPJ2

GIVING BRAINLIEST please its due in 10 min and please show work

Samantha invests a total of $18,000 in two accounts. The first account earned an annual interest rate of 11% and the second account earned an annual interest of 7%. At the end of one year, the total amount of money gained was $1,680.00. How much was invested into each account?

$ was invested in the account that earned 11% and

$ was invested in the account that earned 7%.

Answers

Answer:

Step-by-step explanation:

X + Y =  28500 (Equation 1).

1.11X + .9Y = 29010 (Equation 2).

Can someone help me out on this math problem?

Answers

1 ,3, 1

The first one is 1 the second is 3 and the last one is 1

How i can answer this question

Answers

Answer:

4k+11

Step-by-step explanation:

There you go. Happy to help.

what is the value of the expression 5 + 6 x (5 - 2) + 9

Answers

i believe its 18x + 14

what is 3 1/2 X 2 X 9 1/3

Answers

Answer: 21

Steps: Convert the mixed number to an improper fraction and Reduce the numbers with the greatest common factor

- 7/2 * 2 * 3

Reduce the numbers with the greatest common factor

7 * 3

Answer = 21

HELP PLEASEEEEEE ill give u 30 point plays brainly u dont even have to show ur work

Answers

Answer:

1) 32/7

2) 7/5

3) 13/4

4) 32/15

5) 19/2

6) 57/14

Step-by-step explanation:

Use a calculator and/or multiple the coefficients with the value of the denominator then add it to the numerator and multiply.

Find the value of a and b in parallelogram QRST

Answers

Answer:

a=7

b=11

Step-by-step explanation:

4a=3a+7

-3a -3a

a=7

2b=b+11

-b -b

b=11

sides parallel from eachother in a parallelogram are equal to eachother.

(x+5)²=
(5x+9)²=
(10x²+12)²=
(x³+2x)²=

Answers

just use a calculator

When Zainab started work, her original hourly wage was ‘y’ dollars. Her wage was then doubled, and then increased by $4. If Zainab now gets paid $17 an hour, what was her original hourly wage?

Answers

Answer:

$6.5 dollars

Step-by-step explanation:

We can make an equation to find out the original total.

2y+4=17

(subtract 4 from both sides)

2y=13

(divide by 2)

y=6.5

Hope this helped :D

Quien me ayuda? pls!!!

Answers

Answer:

The answer is B

Step-by-step explanation:

You need to find the derivitive of the equation and ,ultiply by B!!!

evaluate the expression for the given value of x.
4x+9 for x =9​

Answers

45

since x=9 plug in 9 into the equation to get

4(9)+9

multiply 4(9) to get

36

Then add 9

which then equals 45

Answer:

answer is 45

Step-by-step explanation:

4×9=36

36+9=45

The table displays the amount of money Stephen has in his piggy bank.

Stephen’s Piggy Bank
Types of Coins Amount ($)
Quarters 7.50
Dimes 6.00
Nickels 5.50
Pennies 3.00

Which answer choices accurately approximate a comparison between the value of the dimes in the piggy bank and the total value of Stephen’s coins?
Select all the correct answers.


Answer choices:
6%
3/11
6/22
60%
27%
3/5

Answers

Answer:

The answer is 27%, 6/22, and 3/11.

Pls mark brainliest. :D

the area of a window is 192 in squared. The width if the window is four inches more than half the length of the window. What are the dimensions of the window?

Answers

Answer:

Length = 16 inches and width = 12inches

Step-by-step explanation:

A = 192 in² . The width is 4 + 1/2x.  therefore let x = length

Area = LW

192 =  x(4 + 1/2 x)

192 = 4x + 1/2x²      

384 = 8x  + x²                            Multiply each term by 2 to make a  

384 + 16 =  x² + 8x + 16              Complete the square

400 = (x  + 4)²        

[tex]\sqrt{400} = \sqrt{(x + 4)^2}[/tex]

± 20 = x + 4

20 = x + 4  or  -20 = x + 4

20 - 4 = x     or  -20 - 4 = x

    16 = x   or   -24 = x   reject the negative amount

   Length = 16

   width = 4 + 1/2(16);   4 + 8 = 12

Pls help i give 5 stars and crown ​

Answers

Step-by-step explanation:

10 %, 7/10 and 0.2 are the three numbers that add up to 1

0.1 + 0.7 + 0.2 = 1

Answer:

1/4 = 0.25

0.5

10% = 0.1

7/10 = 0.7

15% = 0.15

0.2

10% + 7/10 +0.2 = 1

If 5/3 liters of water is enough to water ⅕ of your yard, 5 3 how much water is needed to water the entire yard?

Answers

Answer:

8 1/3 liters

Step-by-step explanation:

create a proportion from water : yard

let 'y' = water for entire yard

5/3 ÷ 1/5 = y ÷ 5/5

5/3 · 5/1 = y/1

25/3 = y/1

3y = 25

y = 8 1/3

Other Questions
How does the WHO prevent diseases and protect patients?by providing needy countries with low interest loansby facilitating trade that works to improve economiesby donating aid from one specific country to anotherby allowing organizations to collaborate with each other Which landform is formed when an oceanic crust and continental plate meet at a convergent plate margin your parent had to go on an emergency work. Your kitchen was left uncleaned and they forgot to close the gas stove. Suddenly, the towel beside the gas stove is on fire. At your young age, what is the first thing you will do? how would you solve the problem? In a business environment, who is responsible for testing a website?. (1 x 3)+ (7 x 3) as a product of 2 factors What is the sum of the first 32 terms in the arithmeticseries 3 + 10 + 17 + ? What is m The french people supported napoleon bonaparte because they hoped he would: Given the graph below, write an equation in slope-intercept form. plumber what work in job In __________ ribosomes can attach to the mRNA and begin translation even though transcription has not been completed. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Is the graph increasing, decreasing, or constant?A. ConstantB. DecreasingC. Increasing Plant and animal cells are both eukaryotic. This means they...O Have a nucleusO Contain DNA and RNA.O Can reproduce on their own. in what year was the first aicpa conference on current sec developments held? what does the suffix ition mean in the word composition HELPPPPP PLSSSS WILL GIVE BRAINIEST!!!!! did thomas jefferson agree with the federalist papers? pls write a paragraph plssss Like the success of animals, the success of plants is limited based on the resources available to each individual. In the tropicalrainforest, plants are especially limited by the spate they have available to grow and reproduce. Which of these statementsdescribes a way that limited space will impactthe success of a plant in the rainforest? (SC.7.L.17.3)A plant without enough space will face increased predation from herbivoresaO A plant without enough space will not have as many parasites and diseases.3A plant without enough space will be more likely to be impacted by air qualityA plant without enough space will not be able to capture enough light to grow. Why do some atoms form chemical bonds while others do not? How did the Spanish-American war aid the U.S. in becoming a global power?