Can we trust our relatives ?​

Answers

Answer 1

Answer:

I think you should never be too trusting of anyone, even your family.

Explanation:

I don't know the context of this question, but your family can still hurt you, lie to you etc. Not saying you shouldn't trust any family at all, but don't just hand over trust so fast, not even to relatives.


Related Questions

Which of the following best describes relations between colonists and American Indians in the early days of the Georgia colony?
Relations were good due to the policies of James Oglethorpe.
Relations were poor due to the policies of William Berkeley.
Relations were strained due to the Tuscarora War.
Relations improved following Bacon’s Rebellion.

Answers

The best description of relations between colonists and American Indians in the early days of the Georgia colony is relations were good due to the policies of James Oglethorpe. Thus, option A is correct.

What is colony?

Colony is defined as a group of individuals who has been leave their motherland or place of their birth to start farming in a new place or land which is connected along with their own nation.

The Georgia colony was the colonies belong to British America and it belongs to southern part of British America. The Georgia American colony was thirteen original colonies of America.

Therefore, The best description of relations between colonists and American Indians in the early days of the Georgia colony is relations were good due to the policies of James Oglethorpe. Thus, option A is correct.

Learn more about colony here:

https://brainly.com/question/385363

#SPJ1

Is southwest Asia culturally divided?

Answers

Answer:

physical area of this realm is divided into three regions: North Africa, Southwest Asia, and the countries of Turkestan.Explanation:

Which feudal leader was responsible for laying the foundation for the European civilization following the fall of the Roman Empire?

A:Charalemange


B: Wiliam the conqueror​

Answers

Answer:

A: Charalemange.

Explanation:

Molly looks at a yellow notebook under sunlight conditions and she perceives it to be yellow. When she looks at it indoors under tungsten light (which contains less short wavelength light and more long wavelength light than sunlight, it looks ______ to her.

Answers

When she looks at it indoors under tungsten light (which contains less short wavelength light and more long wavelength light than sunlight, it looks yellow to her.

Yellow.

Let's understand what Tungsten Light is all about.

Tungsten LightTungsten Light is the light that glows bright orange in the bulb when current passes through it.

It's name is derived as such because of the tungsten filament that is seen inside the bulb.

It produces a colour temperature of around 3200k.

Thus, when Molly looks at the yellow surface under tungsten light, it still gives a yellow colour.

Learn more about light bulbs on https://brainly.com/question/8979272

in the book of leviticus, god tells what man not to shave his beard?

Answers

The answer to this question is Moses

1. The person who...................... motherland deserves respect and support in every walk of life. (loves/hates) 2. Sky diving, bungee jumping, paragliding, rafting &kayaking etc are some...............the visitors can enjoy in Nepal. (traditional sports/ adventure sports) 3. Preservation of the historical and cultural sites is our................ (identity/duty) ​




this is only fill in the blank

Answers

Answer:

(1) Loves (2) Traditional sports (3) duty

Explanation:

(1) I think it is loves because the person who loves something deserves to be respected.

(2) Nepal has a lot of water so the things listed below would be found very common.

(3) Identity means who you are while duty means it is your right.

I hope this helps

the local mean time for the East always is​

Answers

Answer:

Local Mean Time is the Mean Solar Time for a specific location on Earth. It is the same for all locations that share the same longitude.

Explanation:

BRAINLIEST PLEASE

CARRY ON LEARNING

A step-by-step procedure used to obtain a particular goal when in search for a problem’s solution is a(n) __________. A. Heuristic B. Algorithm C. Subgoal D. Equation Please select the best answer from the choices provided A B C D.

Answers

The name which is given to a step-by-step procedure used to obtain a particular goal when in search for a problem's solution is an:

B. Algorithm

According to the given question, we are asked to state the name which is given to a step-by-step procedure used to obtain a particular goal when in search for a problem's solution.

As a result of this, we can see that an algorithm is a series of well defined steps which a person or a computer would have to undertake in order to solve a problem

Read more about algorithm here:

https://brainly.com/question/24793921

What are the reasons for change in season? Explain

Answers

Answer:

Earth's tilted axis causes the seasons. Throughout the year, different parts of Earth receive the Sun's most direct rays. So, when the North Pole tilts toward the Sun, it's summer in the Northern Hemisphere. And when the South Pole tilts toward the Sun, it's winter in the Northern Hemisphere.

Explanation:

the earths’ rotation.
the earth rotates on the equator causing it to be cold or warm in different places based on how close they are to the equator.

Essay on ancient Mesopotamia (two paragraphs if possible)

Answers

Ancient Mesopotamia was one of the first settlements near the Euphrates River in Africa. Mesopotamians have made many inventions including a version of irrigation which was later developed by ancient Egyptians. Ancient Mesopotamia was also one of the first civilizations to form a language. Their language was called Cuneiform which was a combination of lines formed together which symbols to create words.


(CHANGE THIS UP A BIT!!!)

How did Liliuokalani react to the creation of a new government in Hawaii?

Answers

How did Liliuokalani react to the creation of a new government in Hawaii? Answer: As head of the 'Onipa'a (meaning “immovable,” “steadfast,” “firm,” “resolute”) movement, whose motto was “Hawaii for the Hawaiians,” Liliuokalani fought bitterly against annexation of the islands by the United States. Annexation nonetheless occurred in July 1899.


Picture:

Having a budget can be useless because there are always things that happen in life that change our budget.
O False
O True
Brainly has no answers for me plz help

Answers

Answer:

false

Explanation:

During the last 100 feet prior to an unmarked intersection, a vehicle should slow to ______ miles per hour.

Answers

Based on the information given, it should be noted that in this situation, the vehicle should slow down to no more than 15mph.

It should be noted that when a driver is driving on the road, it's important to take every other road user into consideration and ensure that the road is safe.

Therefore, during the last 100 feet prior to an unmarked intersection, a vehicle should slow to 15 miles per hour. This is important to ensure safety.

Learn more about driving on:

https://brainly.com/question/1071840

why did the in re gault case reach the supreme court

Answers

Answer:

The proceedings for juveniles had to comply with the requirements of the Fourteenth Amendment.

Explanation:

The proceedings of the Juvenile Court failed to comply with the Constitution. The Court held that the proceedings for juveniles had to comply with the requirements of the Fourteenth Amendment.

when driving in the city may help you avoid traffic

Answers

Answer:

The correct answer is side streets.

If you are in a hurry, it may be better to take a different route and drive through side streets in order to avoid the traffic which is usually present in the more 'popular streets.' However, side streets have a lot of traffic control lights, which may slow down your ride even more.

Explanation:

what do you get for beating halo infinite on legendary

Answers

i have no clue u mean the game halo?

why did queen rajyalaxmi make fattejung the prime minister​

Answers

Answer:

Because to make her son as the next king

Explanation:

First of all rajya Laxmi make a one nepali pm to complete her wish but the pm was the country lover so he couldn't agree with the queen rajya Laxmi. So rajya Laxmi dicide to kill him by with the help of jung Bahadur Rana.

Answer:

Following the Kot massacre, Jung Bahadur Kunwar declared himself the prime minister. Queen Rajya Lakshmi- who had always trusted Jung - a very ambitious person who might have promised to help her in making Prince Rajendra - son of Rajya Lakshmi - become the next king, yet he had his own motives.  

Explanation:

how do you know if your catalytic converter is bad

Answers

Look it up online it should tell you

The ocean regulates temperatures, keeping them mild year-round, in __________ climate regions.
A.
continental
B.
moderate
C.
polar
D.
tropical

Answers

Answer:

B moderate

Explanation:

because the water temp is not changing drastically

What channel is the kennedy center honors on tonight?

Answers

CBS, the Columbia Broadcasting System

Answer:

tonight it it on CBS news

Give examples of how a person’s constitutional rights can be limited

Answers

The constitution is a living document… it can change if the majority of the states agree… the Supreme Court is a federal branch of the law… and doesn’t wield the power to change the constitution alone… and at no time is it ok for ones rights to be limited period never. Even criminals have rights… we should use our rights like a loved one scream about them let everyone know because if you quit loving them they will leave too…

2. What is the primary mountain chain that runs through Iran?
1 point
Captionless Image
Taurus Mountains
Zagros Mountains
Elburz Mountains
Himalaya Mountains
3. What is the capital of Iraq?
1 point
Captionless Image
Tehran
Kabul
Damascus
Baghdad
4. Which two countries are to the east of Iran?
1 point
Captionless Image
Iraq
Saudi Arabia
Afghanistan
United Arab Emirates
Pakistan
5. True or False - Based on the population numbers below, Oman has a higher population than Syria.
1 point
Captionless Image
True
False
6. According to the map below, which three cities in Southwest Asia have the highest populations?
1 point
Captionless Image
Baghdad
Tehran
Riyahd
Damascus
Dubai
Istanbul
7. The majority of the Arabian Peninsula is used for what type of "Land Use"?
1 point
Captionless Image
Commercial Farming
Livestock Raising
Subsistence Farming
Nomadic Herding
8. Which "Resource" is the primary resource found throughout the Middle East?
1 point
Captionless Image
Coal
Petroleum
Iron Ore
Cobalt
9. Which climate zone is the primary zone found on the Arabian Peninsula?
1 point
Captionless Image
Mediterranean
Tundra
Arid
Tropical Rain Forest
10. Recent data shows that Festus, MO is moving closer to becoming a Humid Subtropical Climate Zone. Which capital/ country on this map would be in the same type of climate zone?
1 point
Captionless Image
Riyahd, Saudi Arabia
Baghdad, Iraq
Islamabad, Pakistan
Ankara, Turkey

Answers

Answer:

2. option B

3. option D

4. options C and E

5. false

how many full time chefs does the white house have

Answers

Answer: five full-time chefs
With five full-time chefs, the White House kitchen is able to serve dinner to as many as 140 guests and hors d'oeuvres to more than 1,000. The White House requires 570 gallons of paint to cover its outside surface.

White House facts: The White House has 412 doors and 147 windows. The White House has 3 elevators and 8 staircases. The White House has a bowling alley (one lane), movie theater, tennis court, putting green and a swimming pool. There are three major sections of the White House, the West Wing, the East Wing and the Residence.

Answer: The White house has 5 full time chefs.

Explanation:

The accompong maroon festival celebrates the freedom the maroons received from the English

True
False

Answers

The above statement is true.

The Accompong Maroon Festival takes place on January 6 annually to commemorate the signing of the Peace Treaty with the British 283 years ago.This festival marks the victory of the Maroons in the first war against the British in which they fought for their freedom, led by their late hero Cudjoe.So, it is true.

Hope you could get an idea from here.

Doubt clarification - use comment section.

True

Explanation:-

Maroon festival is celebrated on January 6 every year.

It is celebrated by the Maroons

On this day the Maroons defeated British 283 years ago i.e on 1737.

They got freedom from British after this war

Hope it helps

Natalie had random hand movements when she was 2 months old. When she was 6 months old, she would grab a block with her whole hand. Now at the age of 10 months, she can grasp the same block with her thumb and forefinger. This sequence of growth in her hand and finger movements is occurring according to the ________ pattern.

a. Lateralization
b. Proximodistal
c. Endarch
d. Cephalocaudal

Answers

Your answer is B

Good luck!

which thing most important in our life ?​

Answers

As humans or individuals? As individuals it is probably having a trusted one, a back bone who can help you out.

What is a significant impact of the case that determined the U.S. Supreme Court could find acts of Congress unconstitutional??​

Answers

Answer:

Marbury v. Madison strengthened the federal judiciary by establishing for it the power of judicial review, by which the federal courts could declare legislation, as well as executive and administrative actions, inconsistent with the U.S. Constitution (“unconstitutional”) and therefore null and void.

Answer:

there would be a different circumstances

How is the status of population composition by occupation of Nepal in rural and urban area? Explain​

Answers

Answer:

They have lots of shops

Explanation:

So basically they have a lot of things and more peopel come

Explain the differences between an ethnic group and a religious group.

Answers

An ethnic group is a community of people who share common cultural, linguistic, and historical characteristics. On the other hand, a religious group refers to a community of people who share a common faith, belief system, and religious practices.

Ethnic groups often have a shared sense of belonging and identity, which can be based on factors such as nationality, race, or shared geographic origins. For example, the Han Chinese and the Maasai people of East Africa are examples of ethnic groups.

While there can be overlaps between ethnic and religious groups, it's important to note that they are not the same thing. An ethnic group can encompass individuals who may follow different religions or have no religious affiliation at all. Conversely, a religious group can consist of individuals from different ethnic backgrounds who share the same religious beliefs and practices.

To learn more on ethnic group, here:

https://brainly.com/question/30837162

#SPJ6

________ involves tactics used by police interviewers that fall short of physical abuse but still pressure suspects to divulge information.

Answers

Inherent Coercion is the tactics used by the police interviewers who fall short of physical abuse but still pressure suspects to divulge information.

What is Inherent Coercion?

Inherent Coercion is a type of tactics use by police interviewer.

This tactics are used when the police interviewers fall short of physical abuse but still need to pressurize the suspects to provide information.

In conclusion, the Inherent Coercion is the tactics used by the police interviewers who fall short of physical abuse but still pressure suspects to divulge information.

Read more about Inherent Coercion

brainly.com/question/5365988

Other Questions
Nepal is the beautiful garden. Prove it with suitable example How does the WHO prevent diseases and protect patients?by providing needy countries with low interest loansby facilitating trade that works to improve economiesby donating aid from one specific country to anotherby allowing organizations to collaborate with each other Which landform is formed when an oceanic crust and continental plate meet at a convergent plate margin your parent had to go on an emergency work. Your kitchen was left uncleaned and they forgot to close the gas stove. Suddenly, the towel beside the gas stove is on fire. At your young age, what is the first thing you will do? how would you solve the problem? In a business environment, who is responsible for testing a website?. (1 x 3)+ (7 x 3) as a product of 2 factors What is the sum of the first 32 terms in the arithmeticseries 3 + 10 + 17 + ? What is m The french people supported napoleon bonaparte because they hoped he would: Given the graph below, write an equation in slope-intercept form. plumber what work in job In __________ ribosomes can attach to the mRNA and begin translation even though transcription has not been completed. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Is the graph increasing, decreasing, or constant?A. ConstantB. DecreasingC. Increasing Plant and animal cells are both eukaryotic. This means they...O Have a nucleusO Contain DNA and RNA.O Can reproduce on their own. in what year was the first aicpa conference on current sec developments held? what does the suffix ition mean in the word composition HELPPPPP PLSSSS WILL GIVE BRAINIEST!!!!! did thomas jefferson agree with the federalist papers? pls write a paragraph plssss Like the success of animals, the success of plants is limited based on the resources available to each individual. In the tropicalrainforest, plants are especially limited by the spate they have available to grow and reproduce. Which of these statementsdescribes a way that limited space will impactthe success of a plant in the rainforest? (SC.7.L.17.3)A plant without enough space will face increased predation from herbivoresaO A plant without enough space will not have as many parasites and diseases.3A plant without enough space will be more likely to be impacted by air qualityA plant without enough space will not be able to capture enough light to grow. Why do some atoms form chemical bonds while others do not?