match the traits to the characters who appear in acts 1 and 2 of macbeth
strong willed
wavering
loyal
meek
macbeth
banquo
lady macbeth
duncan

Answers

Answer 1

Answer:

Explanation:

I love macbeth so this will be easy!

strong willed - lady macbeth

Loyal - Banquo

wavering- macbeth

meek- Duncan


Related Questions

what are the two major problems with junk food​

Answers

Answer:

1)Junk food has high quantity of preservatives that is harmful for health.

2)Computing junk food can lead to obesity.

Answer:

health risk eg diabetes

Explanation:

the fat in junk food can give diabetes

cardio vascular health issues the fat builds up in your arteries

what time are the kennedy center honors on tonight

Answers

Answer:

9 p.m.

Explanation:

What do corn stems feel like?

Answers

Answer:

The corn cane plant (Dracaena fragrans) is a tropical evergreen tree. It is a popular houseplant and does well when grown in a pot. It has broad green leaves, and some varietals have a yellow variegation running through the center. It is a member of the aloe family and is subject to the same types of diseases that affect aloes. Some of these diseases affect the the canes of the plant.

Explanation:

1 to 10 how good does my dog look healthy​

Answers

Answer:

OMG!!!! YOUR DOG IS SOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO CUTE!!!!!!

Explanation:

A 10!!!

Answer:

for me its a 10 :)

nice dog btw!

Helppppp I need answerssss for all questions the ones I did are wrong

Answers

Answer:

you need a new paper fam

Explanation:

Read the following excerpt from “The Gift of the Magi” and answer the question.

For there lay The Combs--the set of combs, side and back, that Della had worshipped long in a Broadway window. Beautiful combs, pure tortoise shell, with jewelled rims--just the shade to wear in the beautiful vanished hair. They were expensive combs, she knew, and her heart had simply craved and yearned over them without the least hope of possession. And now, they were hers, but the tresses that should have adorned the coveted adornments were gone.

But she hugged them to her bosom, and at length she was able to look up with dim eyes and a smile and say: "My hair grows so fast, Jim! And them Della leaped up like a little singed cat and cried, "Oh, oh!" Jim had not yet seen his beautiful present. She held it out to him eagerly upon her open palm. The dull precious metal seemed to flash with a reflection of her bright and ardent spirit."Isn't it a dandy, Jim? I hunted all over town to find it. You'll have to look at the time a hundred times a day now. Give me your watch. I want to see how it looks on it."

Instead of obeying, Jim tumbled down on the couch and put his hands under the back of his head and smiled."Della," said he, "let's put our Christmas presents away and keep 'em a while. They're too nice to use just at present. I sold the watch to get the money to buy your combs. And now suppose you put the chops on."

The magi, as you know, were wise men--wonderfully wise men--who brought gifts to the Babe in the manger. They invented the art of giving Christmas presents. Being wise, their gifts were no doubt wise ones, possibly bearing the privilege of exchange in case of duplication. And here I have lamely related to you the uneventful chronicle of two foolish children in a flat who most unwisely sacrificed for each other the greatest treasures of their house. But in a last word to the wise of these days let it be said that of all who give gifts these two were the wisest. O all who give and receive gifts, such as they are wisest. Everywhere they are wisest. They are the magi.

What inference can the reader make about Jim’s feelings based on his actions at the end of the passage?

Jim feels contentment with knowing that, although their gifts are useless, their love for each other is strong.
Jim feels helpless to provide a better life for Della.
Jim feels indifference about the outcome since his gift was not costly.
Jim feels frustration because of the ruined gift.

Answers

Answer:

A: Jim feels contentment with knowing that, although their gifts are useless, their love for each other is strong.

Explanation:

Can someone help me with this please.

Answers

Answer:

Here's some reasons (down below).

Explanation:

For one of your reasons, you could say that masks reduce the risks of getting C19, and those who do not wear masks may spread C19 quicker. Masks protect people from the risk of germs and stop the spread of C19 if you were infected (because you'll be the only one coming in contact with your sneezes and coughs, for example.)

Tell your friend about two interesting things you have done recently

Answers

DONE!!!

PLEASE MARK THIS AS THE BRAINLIEST!!

I'm begging

How were Ray Kroc and Walt Disney similar?

A. They both were masterful salesmen.
B. They were both born in Southern California.
C. They both received advanced degrees.
D. They both came from very wealthy families.

Answers

Answer:

I believe it is A. They were both masterful salesmen.

Explanation:

Answer:

A.) They were both masterful salesmen.

which definition fits the word console

Answers

Answer:

A video game console is an electronic device that outputs a video signal or image to display a video game that can be played with a game controller.

Explanation:

or comfort

"Console" pronounced [cun-soul], means to comfort. When it is pronounced [con-soul], it is referring to a video game device.

Drawing from the passage, how does Bertie feel about Gussie?

Answers

Answer:

Bertie is indifferent to Gussie, because Gussie seldom visits

Explanation:

hope i help and have a god bless

Answer: Bertie knows Gussie well, especially that Gussie tends to get into trouble. In "Extricating Young Gussie," it is clear that Bertie and Gussie know each other very well. This is likely to be the reason why Aunt Agatha asks Bertie to stop his cousin Gussie from marrying a vaudeville performer. She is concerned that Gussie will make a mistake by bringing such a woman into his aristocratic family. It is clear from their dialogue that Gussie tends to get into trouble, and that this is something that Bertie knows.

Which of the following best describes
Sobor's main problem in the story
A She does not like cold rain.
B She does not have enough to eat.
C She lost two of her cubs.
D She is alone with her cub.
1

Answers

Answer:

B She does not have enough to eat.

Explanation:

i had that question before like 4 days ago

what is false humility? being dishonest with yourself to please others being a people pleaser being honest with yourself telling part of the truth but not the whole truth

Answers

Answer:

I think it's A.

False humility can be defined as -  being a people pleaser. Therefore option B is the correct response.

What is humility?

Being humble is a trait of humility. According to dictionary definitions, humility emphasizes a low feeling of value and self-regard. In the context of religion, humility may be defined as the acceptance of oneself in relation to a deity or deities and the consequent submission to that deity as a follower of that faith.

The definition of humility is actually fairly straightforward: it is the acceptance of reality via an open mind to the truth. Humble leaders are aware of their own limitations in comparison to those of others and the current circumstances.

Never act with self-centered ambition or arrogant arrogance. Instead, appreciate others more than yourself by putting their interests ahead of your own and acting with humility.

To read more about humility, refer to - https://brainly.com/question/27154738

#SPJ6

What are the best first steps when writing a literary analysis essay?
Gather quotes from the literary text you plan to analyze, and then see what claim you can make them support.
Form an opinion about the value of the literary text and write emotionally compelling phrases to support your opinion.
Analyze the literary work, and write a few statements about it that explain how the work accomplishes its goals.
Research the author's life and then explain how many of the author's real experiences appear in the work itself.

Answers

The 6 major elements of literary analysis are:

PlotSettingCharactersFigurative LanguageStyle  and point of view

The best way to commence a literary analysis essay (in the right order) would be to:

Read the text to identify the literary devices. This will involve taking notes;Formulating a thesis. This essentially is your opinion about the value of the test. Inserting a title and introductionPopulating the body of the essayConclusion

Read more about Literary Analysis Essay in the link below:

https://brainly.com/question/22213034

Answer:

Analyze the literary work, and write a few statements about it that explain how the work accomplishes its goals.

Explanation:

I took the quiz and got this correct.

When should you look up a word in the dictionary? Select all that apply.

when you don't know what the word means
when you want to use a word in your speech
when you need to know how to pronounce a word

Answers

Answer:

when you don't know what the word mean

Which of the following forms of rhetoric are consistent patterns that help the reader make associations with other elements? Select all that apply.

diction
repetition
allusion
parallelism

please help me will give 30 points to correct answer

Answers

Allusion

Allusion is a figure of speech, in which an object or circumstance from unrelated context is referred to covertly or indirectly
Allusion because yea and yea

Replace the adjectives in bold with their opposites
please answer this questions in the photo I need hhelp

Answers

Answer:

1. cramped

2. expensive

3. unrealistic

4. uncomfortable

5. noisy

6. new

In no less than seventy-five words, explain Penelope's weaving project, including the trick she devised to
make it last a long time. Then, explain why the suitors were so furious with her when they found out her
plan.

Answers

Answer:

b

Explanation:

Response Paragraph 1
Three to five sentences long
Explain how the resolution of the plot indicates the author's purpose.
Show what human rights issues took place in the conflict and how the author used the resolution to generate a reaction in the reader.
Use proper spelling and grammar.
( I am reading Their Eyes Were Watching God)

Answers

Answer:

The resolution of a plot is vital in a literary work as it illustrates the theme of the passage or the story.

Your information is incomplete as you'd didn't provide the passage. Therefore, an overview will be given. The resolution of a plot is the conclusion of the story.

The resolution of a story is also known as denouement. It's the event that takes place after the climax.

The diction and characterization used were vital in indicating the author’s purpose for writing about a human rights issue. The author showed the struggles, conflicts, and representation of harmony in African-American culture.

Explanation:

The ability to produce novel and valuable ideas is called:

Answers

Answer: creativity

Explanation: if have creativity I only we can do anything

PLS ANSWER THIS QUESTION THANKS NONSENSE WILL BE AUTO REPORTED ⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️​

Answers

Answer:

Explanation:

1.cells

2.organ

3 organ system

4

5

6

7

8 roots

9 stem

10

hope this helps i dont know the others

Montaigne argues that
benefiting at the expense of
others is actually according to
the laws of nature
(Sec. 3). This appeals to

Answers

Montaigne's argument that benefiting at the expense of others is actually according to the laws of nature appeals to the law of the jungle.

How to explain the information

This law states that in nature, there is a constant struggle for survival and that the strong will always prey on the weak. Montaigne argues that this same law applies to human society, and that those who are able to benefit at the expense of others are simply following the natural order of things.

Montaigne's argument is controversial, and there are many who would argue that it is morally wrong to benefit at the expense of others. However, Montaigne's argument is also thought-provoking, and it forces us to consider the nature of human society and the role of competition in our lives.

In addition to the law of the jungle, Montaigne's argument may also appeal to the survival of the fittest.

Leans more about Montaigne on

https://brainly.com/question/31447167

#SPJ1

How does Obama use rhetoric in paragraph 6 to advance his point of view?

Answers

Answer:

To dispel the fears of some white Americans and to advance his chances for election, Obama delivered a major address on race in America, a speech that was praised even by some of his adversaries. Obama had/has a gift for language. He is a skilled orator. To neutralize that advantage, his opponents – including Hillary Clinton at one point – would characterize Obama’s words as empty “rhetoric” – an elaborate trick of language.

Explanation:

Had to do this last week

i want to know what if i call a girl is cat, like '' hi cat, or good morning cat'' is it bad, disrespectfully, or another's mean..... and how about for men

Answers

Answer:

"Hello, kitty!" Would be better. I don't know what you would call a male cat...

Explanation:

I need help with every questions

Answers

Lol all the questions don’t make sense

A FOX one day fell into a deep well and could find no means of escape. A Goat, overcome with thirst, came to the same well, and seeing the Fox, inquired if the water was good. Concealing his sad plight under a merry guise, the Fox indulged in a lavish praise of the water, saying it was excellent beyond measure, and encouraging him to descend. The Goat, mindful only of his thirst, thoughtlessly jumped down, but just as he drank, the Fox informed him of the difficulty they were both in and suggested a scheme for their common escape. “If,” said he, “you will place your forefeet upon the wall and bend your head, I will run up your back and escape, and will help you out afterwards.” The Goat readily assented and the Fox leaped upon his back. Steadying himself with the Goat’s horns, he safely reached the mouth of the well and made off as fast as he could. When the Goat upbraided him for breaking his promise, he turned around and cried out, “You foolish old fellow! If you had as many brains in your head as you have hairs in your beard, you would never have gone down before you had inspected the way up, nor have exposed yourself to dangers from which you had no means of escape.”


What is the moral of the story?

Answers

Answer:

You should not blindly trust anyone and should always think for yourself before taking any actions.

This is demonstrated in the tale by the way the goat follows the fox's instructions without stopping to consider the hazards it faces.

What is a story?

A story can be defined as a plot that describes an incident or an event. This tells about a message or morale that the person needs to gain. A story Can be fictitious that is it can be natural or not depending upon the author or the teller. The story has a plot character and theme around which the story is made. It depends upon the writer or the reader of the story to depict the story.

Never put your complete reliance in anybody, and always exercise your own judgment before acting. A Fox accidentally fell down a deep well and had no way to get out. The same well was visited by a goat who was parched and inquired about the water quality.

As quickly as he could, the Fox jumped onto the goat's back and fled. He sobbed loudly when the Goat chastised him for breaching his commitment.

Learn more about story, Here:

https://brainly.com/question/27826391

#SPJ2

Write one to two sentences explaining how his mother compares the staircase to life in the poem

Answers

Answer:

Well a staircase is like life you have your ups and downs. You could fall down all the time but get back up.

Explanation:

Based on this passage, what inference can be made about the English teacher?

Answers

Answer: Since the passage is not included, I will try my best to help!

Explanation: To make an inference on the English teacher, you must find clues in the passage.

Example: My English teacher walked into the room, Her stomps were loud her face was red, her fists were clenched. We can inference that the teacher is mad.

clues: she was stomping, her face was red, and her fists were clenched.

I hope this helps!

PLS ANSWER THIS QUESTION THANKS NONSENSE WILL BE AUTO REPORTED ⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️​

Answers

Answer:

2. Ally

3. Live

4. Thankful

5. Happy

6. comfort

7. forgiveness

8. Relief

9. *I donno sorry :( *

10. Repair

Explanation:

What is the cartoonist's purpose in this cartoon? to convince people that fungal bands are dangerous for beetles to convince people that beetles are damaging to trees to make people laugh at a play on words to make people believe that longhorn beetles hate fungi.

Answers

A bccccc fungal bands are dangerous
Other Questions
What is x, the distance between points S' and S? x = 2.25 units x = 2.5 units x = 4.25 units x = 4.5 units Nepal is the beautiful garden. Prove it with suitable example How does the WHO prevent diseases and protect patients?by providing needy countries with low interest loansby facilitating trade that works to improve economiesby donating aid from one specific country to anotherby allowing organizations to collaborate with each other Which landform is formed when an oceanic crust and continental plate meet at a convergent plate margin your parent had to go on an emergency work. Your kitchen was left uncleaned and they forgot to close the gas stove. Suddenly, the towel beside the gas stove is on fire. At your young age, what is the first thing you will do? how would you solve the problem? In a business environment, who is responsible for testing a website?. (1 x 3)+ (7 x 3) as a product of 2 factors What is the sum of the first 32 terms in the arithmeticseries 3 + 10 + 17 + ? What is m The french people supported napoleon bonaparte because they hoped he would: Given the graph below, write an equation in slope-intercept form. plumber what work in job In __________ ribosomes can attach to the mRNA and begin translation even though transcription has not been completed. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Is the graph increasing, decreasing, or constant?A. ConstantB. DecreasingC. Increasing Plant and animal cells are both eukaryotic. This means they...O Have a nucleusO Contain DNA and RNA.O Can reproduce on their own. in what year was the first aicpa conference on current sec developments held? what does the suffix ition mean in the word composition HELPPPPP PLSSSS WILL GIVE BRAINIEST!!!!! did thomas jefferson agree with the federalist papers? pls write a paragraph plssss Like the success of animals, the success of plants is limited based on the resources available to each individual. In the tropicalrainforest, plants are especially limited by the spate they have available to grow and reproduce. Which of these statementsdescribes a way that limited space will impactthe success of a plant in the rainforest? (SC.7.L.17.3)A plant without enough space will face increased predation from herbivoresaO A plant without enough space will not have as many parasites and diseases.3A plant without enough space will be more likely to be impacted by air qualityA plant without enough space will not be able to capture enough light to grow.