Paul is writing a poem to submit to a national writing contest.

Which line should he include to fulfill the simile requirement?

A.
The flower wilted like a tired child.
B.
The fragile flower wilted in the wind.
C.
The flower stood tall and did not fall.
D.
The delicate flower whispered softly.
You will be awared at least 20 points

Answers

Answer 1

Answer: A

Explanation: This option uses the word "like" this word is an indicator of simile.

Answer 2

Answer: The answer is A.

Explanation:

A.

The flower wilted like a tired child.

Hope I helped :)


Related Questions

Identify the ambiguous pronoun. At the assembly, he explained the new lunch policy for seniors.



options:

assembly


he


lunch policy


seniors

Answers

In the ambiguous pronoun, at the assembly, he explained the new lunch policy for seniors. The correct option is d.

What is an ambiguous pronoun?

An ambiguous pronoun occurs when a sentence contains two possible antecedents, leaving the reader or listener unaware of which the pronoun is referring to, also known as a faulty pronoun reference. As a way to avoid ambiguity, it is best to place the pronoun close to its antecedent.

In grammar, a pronoun is a word that substitutes for either a noun or a noun phrase. The word the pronoun substitutes for is called the antecedent. There are over 100 pronouns. An ambiguous pronoun occurs when a sentence contains two possible antecedents, leaving the reader or listener unaware of which the pronoun is referring to, also known as a faulty pronoun reference.

As a way to avoid ambiguity, it is best to place the pronoun close to its antecedent.

Learn more about pronoun, here:

https://brainly.com/question/7942658

#SPJ2

In Chapter 2 What is brians Internal conflict and external conflict

Answers

What book is this from?

Which sentence is the correct punctuation usage of the semicolon, colon, or comma?

A
He was a world class athlete, a rowing champion.

B
He was a world class athlete a rowing, champion.

C
He was a world class athlete: a rowing champion.

D
He was a world class athlete; a rowing champion.

Answers

Answer:

D

Explanation:

There should be a pause there.

Answer:

D is the correct answer

Explanation:

Trust meh

Please help me with this question ! :<

Happy holidays ! [ New years is soon :3 ]

Answers

Answer:

I think the answer is the word "territories" in the last sentence in the first paragraph "As the centuries went on, however, Christian forces began to take control of Spanish territories."

Explanation:

The word "territories" is just a plural for of the word "territory", which means:

ter·ri·to·ry

/ˈterəˌtôrē/

noun

Definition:

1. An area of land under the jurisdiction of a ruler or state.

"sorties into enemy territory"

Similar:

2.(especially in the US, Canada, or Australia) an organized division of a country that is not yet admitted to the full rights of a state.

Hope this helps! ;)

According to Misha at the beginning of ch.22, how has his identity changed once again?

He is now known as the flop-flattener and is feared in the Ghetto


He is rid himself of his Gypsy identity and adopted the last Milgrom


He has returned to the name StopThief because Thefts on the other side of the wall

HELP ME PLZ!!

Answers

Answer:   Janina is a young Jewish girl, seven years old at the beginning of the novel, whom Misha befriends when he wanders into her backyard and steals a tomato from her garden. She’s Mr. and Mrs. Milgrom’s daughter and Shinsel’s niece. Janina has curly hair and huge brown eyes. Upon meeting Misha, she invites him to her birthday party. She and Misha reunite during the march to the ghetto, when Misha attaches himself to her family. Janina is spirited, willful, and very spoiled. She can even be quite bratty, screaming at her sick mother, throwing Misha’s belongings over the ghetto wall, and trying to get him into trouble. Janina is also stubborn, determined, and brave.

Explanation:

Why has the author chosen to include the word metamorphasis in the text?

Answers

Answer:

The author uses the word "metamorphosis" to describe the "four-stage process of change." They are introducing new vocabulary terms in a friendly context.

Explanation:

Answer: Because metamorphosis is a very creative word for saying a change of the form or nature of a thing or person into a completely different one, by natural or supernatural means.

Explanation:

Someone helps me with this question please! I will give brainliest

Read the lyrics from Natalie Merchant's song "Wonder."

with love, with patience and with faith
she'll make her way

How might these words have inspired the author of the novel Wonder?

They may have made the author decide that August's mother should have only two children, because raising a lot of children is hard work.
They may have inspired the author to make August's character have to be homeschooled and his sister's character be able to go to a regular school.
They may have made the author decide that August's character should be a boy to avoid any confusion between the novel and the song.
They may have inspired the author to make August's character strong enough to face the challenges of a new school with the loving support of his family.

Answers

Answer:

They may have inspired the author to make August's character strong enough to face the challenges of a new school with the loving support of his family

Explanation:

it seems most accurate

Answer:

In Natalie Merchant's song Wonder, she sings about a girl who will make her way "with love, with patience, and with faith". These very words may have inspired the author to make the young boy Auggie's character strong enough to be able to overcome the challenges that he will face in the new school. Added to that, the support of his loving family members, even his own sister Olivia will also help him face the challenges. So yes it may have influenced the author to make August's personality strong enough to face challenges

Explanation:

brain brain pleaseeeeee :)

PLZ HELP WILL GIVE BRAINLIEST

How do we know that some pattern, rhythm, or meter was present in some of the Psalms?

Many psalms were sung.
The first line of the Psalm states the pattern.
Many musical words and notes are used in the psalms.
Rhythm is detected when a psalm is read aloud.

Answers

Answer: 2 Many musical words and notes are used in the psalms

Explanation:

Because I’d you re-read it over you will see it’s psalms and more reread

Write a short definition for parallelism.

Write a short definition for synonymous.

Write a short definition for synthetic.

Write a short definition for antithetical.

Write a short definition for emblematic.

Answers

Parallelism - between the two species of a plant or an animals is one difference of others

Synonymous - having someone of a synonymous like reference to runners

Synthetic - relating to or a affect the body to systemic disease

Antithetical - the nature or opposed. Or contrasted like the opposite

Answer:

emblematic: of, relating to, or constituting an emblem : symbolic, representative.

Explanation:

Which phrase best defines a sitcom?

a series of interconnected episodes following a set group of characters

a series of self-contained episodes following a set group of characters

a stand-alone episode designed to gauge interest in a show

a series of self-contained episodes following a rotating group of characters

Answers

Answer:

set group of characters

a series of self-contained episodes following a set group of characters

Explanation:

on usually weekly ,and in sucession

Answer: C

A stand alone episode designed to gauge interest in a show

Plz help ;-; 20 points
Suppose you read this sentence in a science report: "The overuse of germ-killing soaps is making some diseases more dangerous." What can you infer about the germs that cause these diseases?
Washing your hands before meals is no longer necessary.
Soap that is supposed to kill germs is poisonous.
Some germs are not actually killed by the soap.
Germs prefer a clean environment.
not B

Answers

Answer:

About 75 percent of liquid antibacterial soaps and 30 percent of bars use a chemical called triclosan as an active ingredient. The drug, which was originally used strictly in hospital settings, was adopted by manufacturers of soaps and other home products during the 1990s, eventually ballooning into an industry that's worth an estimated $1 billion. Apart from soap, we've begun putting the chemical in wipes, hand gels, cutting boards, mattress pads and all sorts of home items as we try our best to eradicate any trace of bacteria from our environment.

I believe that it is Germs are not actually killed by soap bc it is the most rational answer

Which word is a synonym of deficient? HELP ME PLZ!!!!!!!

Answers

Answer:

Sorry i dont understand

Explanation:

Can someone help me pls? :( I will mark you the Brainliest.

Answers

Answer:

id go with option 3 since it is the simplest one.

Explanation:

this is the best option, i know cause ive done the same assignment once. I hope this helps you!

What is ironic about how Janina obeys her father’s orders not to smuggle with Misha?

HELPP MEEEEEE PLZZZZZZZZZ!!!!!!!!!!!!!!!!!

Answers

Explanation:

Technically Janina obeys her father and stops going with Misha to the other side of the wall.

Does she stop smuggling ?No ,Janina goes on her own to smuggle

Answer:

She follows her father's orders and doesn't follow Misha but then goes on her own

Explanation:

Find the following verses in the Book of Psalms. Study the verses and write the synthetic parallel that the verses use.

Psalm 1:1–2

Answers

Answer: here is the verse now you do the rest of the work

Explanation: Blessed is the man who does not walk in the counsel of the wicked or stand in the way of sinners or sit in the seat of mockers. But his delight is in the law of the LORD, and on his law he meditates day and night.

Answer:

1 Blessed is the man

who walks not in the counsel of the wicked,

nor stands in the way of sinners,

nor sits in the seat of scoffers;

2  but his delight is in the law of the Lord,

and on his law he meditates day and night.

Write the meaning of what these verses mean to you

Explanation:

~Bee~

In Chapter 16 of Hatchet, a tornado directly hits Brian's shelter and Brian is left with nothing but the hatchet. How does Brian respond to this setback?

1. Brian has a sense of humor about the tornado, and he feels motivated to rebuild his shelter.

2. Brian remembers the decisions he made earlier and uses them to guide how he rebuilds his shelter.

3. Brian's anger causes him to shut down at first, but he quickly realized the importance of recreating his shelter.

4. Brian experiences despair because he is hurt and has nothing left without his shelter.

Answers

4:Brian experiences despair because he is hurt and has nothing left without his shelter
I was asked the same question

In Chapter 16 of Hatchet, when a tornado directly hits Brian's shelter and Brian is left with nothing but the hatchet he experiences despair because he is hurt and has nothing left without his shelter. Thus, the correct answer is option 4.

What is a Hatchet?

Hatchet is an American writer Gary Paulsen's 1986 Newbery Honor-winning young-adult wilderness survival novel. It is the first of five novels in the Hatchet series. The River, Brian's Winter, Brian's Return, and Brian's Hunt are among the other novels in the series.

In Chapter 16 of the story Hatchet, Brian is left with nothing but the hatchet, he is full of despair and is hurts and has noting left except a shelter because of the tornado.

Therefore, the statement 4 describes how Brian respond to this setback.

To learn more about Hatchet, click here:

https://brainly.com/question/7388268

#SPJ2

PLZ PLZ PLZ PLZ PLZ hurry and help it's between b and d i think
this is fro character ed

Answers

Answer:

Its D i think

Explanation:

B sounds a little too confident

B. Saying of course I can helps because it is saying I can do it rather than I’ll try to do it. hope it helps

which sentence most clearly contains idiom?

Answers

Answer:

d, His mouth was writing checks his body couldn't cash

Explanation:

idiom

in counting by 7s 1. counting by sevens what did Willows evaluation Reveal 2. Name one thing Willow disliked about kindergarten 3. What type of sickness is Willow most interested in 4. What are three reasons willow leaves the house

Answers

Answer:

i don't understand

Explanation:

i don't understand

How did most Roman plebeians make a living?


1. as slaves and servants


2. as soldiers and generals


3. as farmers and traders


4. as senators and priests

Answers

Answer:

answer: 2 farmers and generals or soldiers and generals

Explanation:

Plebeians were average working citizens of Rome – farmers, bakers, builders or craftsmen – who worked hard to support their families and pay their taxes.

Some plebeians, who were doing reasonably well, might try to save enough money to join the equestrian class. For many, however, life was a daily struggle.

Although patricians are often represented as rich and powerful families who managed to secure power over the less-fortunate plebeian families, plebeians and patricians among the senatorial class were often equally wealthy.

All the other citizens of Rome were Plebeians. Plebeians were the farmers, craftsmen, laborers, and soldiers of Rome. In the early stages of Rome, the plebeians had few rights. All of the government and religious positions were held by patricians.

Answer:

3. As farmers and traders.

Explanation:

According to pbs.org, "Plebeians were average working citizens of Rome – farmers, bakers, builders or craftsmen – who worked hard to support their families and pay their taxes."

The Ornithopter

Many people know Leonardo da Vinci today as an artist, and it is true that he was indeed a great painter and sculptor, but he was also an inventor and one of the first individuals in recorded history to draft detailed plans for a flying machine.

In order to make a living, Leonardo often depended upon wealthy individuals who would commission work from him. That means they would hire him and pay him to create specific work they wanted. In 1482, when he was 30 years old, Leonardo heard of an opportunity to work for Ludovico Sforza, the Duke of Milan. The duke, however, did not want a painter; he wanted a military engineer to help him defend the city against its enemies. This was an excellent opportunity that would pay Leonardo well, but Leonardo was a peaceful man. He considered war to be “a beastly madness.” He preferred to make things of beauty.

Leonardo made the decision that he could tolerate making weapons if the resources the duke could provide would also allow him to create things he loved. He sent a letter to the duke detailing his skills in designing and building weapons. “I will assemble catapults, mangonels, trebuchets and other instruments of wonderful efficiency…I will make an infinite number of items for attack and defense,” he wrote.

Leonardo’s letter convinced the duke of his talents, and he got the job. He set about designing the weapons that the duke desired. But Leonardo was infinitely creative, always thinking of new things, new ideas—he could not be limited to weapons alone. One idea that he had not mentioned in his application was the ornithopter. It was not a weapon of war, and it was not something that the duke had asked for, but Leonardo went ahead and designed it anyway.

Leonardo was fascinated by the idea of flight. The word “ornithopter” comes from two words meaning “bird” and “wings.” And on first inspection, his plans resembled a bird’s wings attached to a human being’s arms. He concluded that a human being’s arms were neither strong enough nor light enough to stay in the air for long. So, his design included sets of foot pedals and levers that were operated with the hands. He created detailed plans and presented them to the duke, uncertain of how the duke would react to a design for which he didn’t ask.

As it turned out, the duke was very impressed with the ornithopter, but it wasn’t Leonardo’s innovation that excited him. He immediately thought of the ways this machine could be used in war. If a spy could fly over the enemy’s camp, imagine what information he could gather! This was not what Leonardo had intended for his beautiful flying machine.

But how Leonardo felt about war turned out not to matter in the end. His ornithopter was never built—along with his designs for tanks, parachutes, diving suits, machine guns, and even robots that he created for the duke. The ideas of Leonardo da Vinci were centuries ahead of the technology needed to make them.



He created detailed plans and presented them to the duke, uncertain of how the duke would react to a design for which he didn't ask.

Which type of conflict is expressed in this excerpt?


A. individual vs. nature

B. individual vs. individual

C. individual vs. society

Answers

The answer is c . Individual vs society

which example is a medium

Answers

Answer:

C

Explanation:

Hope this helps

Podcast is a medium.

I checked on go ogle to check my answer. This is what it said.

"Podcasting as simply the dissemination of media files with RSS feeds, it's a medium."

Which line from the poem uses alliteration to create a clicking sound?
A. Every bump and breath, between bark and brick
B. The crabgrass and crickets chirped under the campers' toes.
C. An empty echo eeked out in the night.
D. The thicket of trees thirsted for the rain.

Answers

Answer: A, every bump and breath, between bark and brick

Answer:

A.) Every bump and breath, between bark and brick.

Why is this happening again. Help. -_-
How is the conflict in a novel different from the conflict in a short story?
Characters in a novel resolve the conflict right away.
In a novel, the conflict is much harder to figure out.
In a novel, the conflict always involves a disagreement.
Characters in a novel face the same conflict over and over.

Answers

B or much harder to figure out. Novels are much longer than short stories so the conflict is usually harder. Hope this helps.

Answer:

Characters face the same conflict over and over

Explanation:

That one main conflict has to last the whole novel, so the characters keep facing that conflict, even if it’s not head on

What kind of words are most useful for creating an experience for readers?

confusing words
precise words
vague words
generic words

Answers

Answer:

i believe its precise words. pls tell me if im wrong

In chapter 24, why is Docter Korczak so desperate for Misha to find the cow, if it even exists?


NEED HELP RIGHT NOW!!!

THIS IS MY WINTER BREAK HW!!!!!!

WILL GIVE BRAINLEST FOR THE RIGHT ANSWER!!!!!!!!

Answers

the cow is a symbol of hope for them in some way

Answer:

In chapter 24, why is Doctor Korczak so desperate for Misha to find the cow, if it even exists? The cow is a symbol of hope for them in a way, so he's telling Misha to find hope or happiness. ... An author will often use symbolism to emphasize some deeper meaning in his/her story.

According to your The Hatchet: Brian's Changing Attitudes chart, in Chapter 9, Brian uses the hatchet to __________

1. cut willows for braces.

2. start a fire.

3. scare away a skunk.

4. make a spear for fishing.

Answers

Brian uses the hatchet to Start A Fire.

.
Read the sentence.

The first atomic bomb, exploded on the White Sands Proving Grounds, was tested in 1945.

Which is a true?

The participial phrase starts with the words was tested.
The participial phrase modifies the word bomb.
The participial phrase comes before the word it modifies.
The participial phrase uses a present participial.

Answers

Answer:

the first sentence.

The first atomic bomb that exploded on the White Sands Proving Grounds, was posted in 1945.

Explanation:

On 16 July 1945, the 'Trinity' nuclear test plunged humanity into the so-called Atomic Age. The first-ever nuclear bomb was detonated in New Mexico, at the Alamogordo Test Range. Nicknamed the “gadget”, the plutonium-based implosion-type device yielded 19 kilotons, creating a crater over 300 metres wide.

Significant events. The first atomic bomb (code named Trinity) was test detonated at Trinity Site near the northern boundary of the range on 16 July 1945, seven days after the White Sands Proving Ground was established.

Please help me with this question ! :<

Happy holidays ! [ New years is soon :3 ]

Answers

Debut is the answer because the definition of debut means to introduce first or appear first.

I need help on question D And you will have to look at the answer from question C !
I need answer ASAP PLZ! First one to answer will get a brainliest! And plz nooooo scam link!

Answers

Answer:

Her acceleration is 4 mph.

Explanation:

hope this helps!! :P

Answer:

2mph

Explanation:

Other Questions
What is the sum of the first 32 terms in the arithmeticseries 3 + 10 + 17 + ? What is m The french people supported napoleon bonaparte because they hoped he would: Given the graph below, write an equation in slope-intercept form. plumber what work in job In __________ ribosomes can attach to the mRNA and begin translation even though transcription has not been completed. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Is the graph increasing, decreasing, or constant?A. ConstantB. DecreasingC. Increasing Plant and animal cells are both eukaryotic. This means they...O Have a nucleusO Contain DNA and RNA.O Can reproduce on their own. in what year was the first aicpa conference on current sec developments held? what does the suffix ition mean in the word composition HELPPPPP PLSSSS WILL GIVE BRAINIEST!!!!! did thomas jefferson agree with the federalist papers? pls write a paragraph plssss Like the success of animals, the success of plants is limited based on the resources available to each individual. In the tropicalrainforest, plants are especially limited by the spate they have available to grow and reproduce. Which of these statementsdescribes a way that limited space will impactthe success of a plant in the rainforest? (SC.7.L.17.3)A plant without enough space will face increased predation from herbivoresaO A plant without enough space will not have as many parasites and diseases.3A plant without enough space will be more likely to be impacted by air qualityA plant without enough space will not be able to capture enough light to grow. Why do some atoms form chemical bonds while others do not? How did the Spanish-American war aid the U.S. in becoming a global power? Which is the best inference from the author's statement that world war ii ""ended the great depression""? the best inference from the author's statement is that. pleeeeease help meeeeeee perfectly competitive market in long run equilibrium. if demand decreases, we can be certain that price will Which of these statements about game design is FALSE?Game design involvesincorporating user feedback toimprove the platform.Games design is not a STEMcareer because it is just aboutmaking entertainment.Game design is iterative.Game design requires many teammembers with lots of differentareas of expertise. Ocupo poner Palabras homfonas.