Please help me with this problem!

Please Help Me With This Problem!

Answers

Answer 1

Answer:

57 degrees

Step-by-step explanation:

It is an isosceles triangle because QP has the same length as OP. So the base angles will be the same.


Related Questions

Need help ASAP!!!!!!​

Answers

Answer:

graph b

Step-by-step explanation:

If a = 3.9 cm, b = 2.5 cm, c = 4.6 cm, d = 3.5 cm, and e = 1.2 cm, what is the perimeter in centimeters of the polygon? Do NOT label your answer. Use numbers ONLY.

Answers

Answer:

perimeter= 3.9+2.5+4.6+3.5+1.2= 15.7cm

HELPP PLS I NEED THIS WUICK ILL GIVE BRAINLEST

Answers

Answer:

x = 20

Step-by-step explanation:

(2x+10) = 180 - 130

2x + 10 = 50

2x= 40

x = 20

hope this helps! :)

When is f(x) when x=-5

Answers

Answer:

f is equivalent to 15 and when you replace x with -5 you will have to multiply 15×(-5) and you will get -75 as an overall answer.


A music store purchases a grand
piano, wholesale, for $5,000.
They markup the retail price 65%.
What is the retail price?

Answers

Answer: 8250

Step-by-step explanation:

Answer:

8548

Step-by-step explanation:

tim and sue share a small pizza. tim eats 2/3 o the pizza

Answers

Answer:

Sue eats 1/3 of the pizza

Step-by-step explanation:

Answer:

Sue eats 1/3 of the pizza

Step-by-step explanation:

3/3 - 2/3 = 1/3

WILL GIVE BRAINLIEST
Select the graph of the solution. Click until the correct graph appears.



| x | = 2

Answers

Answer:

It is the second graph, the one with two filled in dots, but no line.

Step-by-step explanation:

The reason it is not the first one is because it has not filled in dots, AND no line, so it's basically saying there is no answer, which is not true.

The reason the third one (the one with a line) is wrong is because, for example, x cannot be 1, because 1 ≠ 2, and if there is a line, it should be true.

Answer:

its the awnser with the 2 not the -2

Step-by-step explanation:

A baker has 12 pounds of almonds. She puts them in bags, so that each bag has the same weight. Clare and Tyler drew diagrams and wrote equations to show how they were thinking about 12 divideDid divide by 6

Answers

Okay wait for a moment I’ll give u the answer

You are running a concession stand at a basketball game. You are selling hot dogs and sodas. Each hot dog costs $2.25 and each soda costs $1.50. At the end of the night you made a total of $225.75. You sold a total of 126 hot dogs and sodas combined. You must report the number of hot dogs sold and the number of sodas sold. What equations did you use to solve this? How many hot dogs were sold and how many sodas were sold?

Answers

Answer:

49 hot dogs, 77 sodas

Step-by-step explanation:

2.25h + 1.5s = 225.75

h + s = 126, so s = 126 - h. Substitute that into the first equation.

2.25h + 1.5(126 - h) = 225.75

Solve for h

2.25h + 189 - 1.5h = 225.75

0.75h = 36.75

h = 49  So they sold 49 hot dogs

h + s = 126, so 49 + s = 126, s = 77

If sixteen dried beans weigh one ounce, then how many dried beans wiring one pound

Answers

Answer:

96 dried beans will weigh one pound

16 beans in one ounce x 16 ounces in a pound = 256 beans total.

Can someone help me with this?

Answers

Step-by-step explanation:

the average rate of change is

(f(x2) - f(x1)) / (x2 - x1)

(a)

(f(4) - f(-6)) / (4 - -6) = (3 - 1) / (4 + 6) = 2 / 10 = 1/5

(b)

(f(2) - f(-2)) / (2 - -2) = (-1 - -3) / (2 + 2) = (-1 + 3) / 4 = 2/4 = 1/2

Will mark brainly!

What is the inverse of [tex]f(x)=\frac{2}{x-1} +6?[/tex]
[tex]f^{-1} (x)=\frac{2}{x-1} +6[/tex]
[tex]f^{-1} (x)=\frac{2}{x} +7[/tex]
[tex]f^{-1} (x)=\frac{2}{y-6} +1[/tex]
[tex]f^{-1} (x)=\frac{2}{x-6} +1[/tex]

Answers

Answer:

[tex] {f}^{ - 1} (x) = \frac{2}{x - 6} + 1[/tex]

Step-by-step explanation:

we will subistitute f(x) by y and solve the equation in order to get the value of x,

then we subistitute x by y and y by x and y=f^-1(x)

can you help solve this? ​

Answers

Answer:

Step-by-step explanation:

What is the distance between -9and -2 on the number line

Answers

Answer:

7 units

Step-by-step explanation:

Calculate the distance using the absolute value function

| - 9 - (- 2) | = | - 9 + 2 | = | - 7 | = 7

or

| - 2 - (- 9) | = | - 2 + 9 | = | 7 | = 7

The distance between -9 and -2 on the number line is -7.

Set up a proportion and solve for x.
1) If I can make up one test in 30 minutes, how long will it take me to make 11 tests?
Can you please help this is due tomorrow and it’s almost Christmas break:((

Answers

30x11 is 330.

300mins

Sorry i'm a little tired, if you want ask me how i got it and show my work in the comments. Thanks u

if 2-5 = -4 then x =



please answer

Answers

Answer:

1

Step-by-step explanation:

2-5=x-4

subtract the common factors

-3 = x-4

add 4 to both sides so get x by itself

1 = x

Hurry up some one answer Which statement about the graph of a linear function is true?
A
The graph intersects the x-axis in two unique places.
B
The graph intersects the y-axis in two unique places.
C
The graph is a curved line.
D
The graph is a straight line.

Answers

Answer:

D

Step-by-step explanation:

Answer:

D

Step-by-step explanation:

Linear functions are those whose graph is a straight line. A linear function has the following form. y = f(x) = a + bx. A linear function has one independent variable and one dependent variable. The independent variable is x and the dependent variable is y.

The military academy is placing cadets in rows for the parade. All rows must have the same number of cadets. If A company has 64 cadets and B company has 80 cadets, what is the greatest number of cadets who can be in each row?

Answers

Answer:

72

Step-by-step explanation:

If we find the average for both companies, it is 72, therefore there are two rows each with 72 cadets

Answer:

the answer is 16 please make me brainliest :> thx uuu

If g(x) =3-2x, find g(-1) (show work)

Answers

g(-1)=3-2(-1)
=5
Hence the correct answer should be 5

solve the equation 1 = u over 2

Answers

Answer:

u = 2, as we multiply both sides by the denominator (2).

Overnight the low temperature dropped to-6 degrees Fahrenheit. If the temperature during the was 11 degrees Fahrenheit, what was the difference between the high and low temperatures?

Answers

Answer:

17 degrees F

Step-by-step explanation:

11 - (-6) = 17

Subtracting a negative is the same as adding.

In how many ways can you arrange six trophies on a shelf?

Answers

Answer:

720 ways

Step-by-step explanation:

Assuming order doesn't matter, there are [tex]6!=6*5*4*3*2*1=720[/tex] ways to arrange six trophies on a shelf.

evaluate p-q if p=14 and q=13

Answers

Answer:

Value of [tex]p-q=1[/tex]

Step-by-step explanation:

We need to find [tex]p-q[/tex]

[tex]p-q=14-13\\\\=1[/tex]

[tex]\huge\boxed{\sf{Hello\:there!}}[/tex]

We are asked to evaluate p-q.

Now, if we aren't given the value of every variable, evaluating this expression is impossible. However, we do have the value of p (14) and the value of q (13)

We plug these numbers instead of the variables:

p-q

p=14

q=13

14-13

1

Hence, the value of the expression is 1.

[tex]\huge\boxed{\sf{Hope\:it\:helps.\:Please\:mark\:Brainliest.}}[/tex]

[tex]\huge\bold{Good\:luck!}}[/tex]

[tex]\huge\mathfrak{LoveLastsAllEternity}[/tex]

what are the zeros of the function of y=x^2-3x+2​

Answers

Answer:

1 and 2

Step-by-step explanation:

Zeros of the function is where the function intersect with x-axis (or in other way the zeros of function is x value when y = 0 )

y=x^2-3x+2​

(we substitute y with zero)

0 = x^2-3x+2​

or in other way

x^2-3x+2​ = 0

Then we factor out the function by using the grouping method

(When we should give two numbers that there sum is equal -3 and if we multiply them we get 2)

and these two numbers are -2 and -1

x^2-3x+2​ = 0

*Substitute the middle term with -x-2x

x^2-x-2x+2​ = 0

*factor out x , then factor out -2

x(x-1)-2(x-1) = 0

*factor out x-2

(x-2)(x-1)=0

Either

x-2 = 0

So

x = 2

Or

x-1 = 0

So

x = 1

in conclusion the zeros of this function is 1,2

Which numbers are irrational numbers?
Select each correct answer.

Answers

the correct answer is B

Answer

Well pi is an irrational number because it can't be simplified into a fraction. And from what I can see neither can the sqaure root of 10/49. So I believe it would be both of them. But if there is only one answer than i'm not sure sorry. But it also says each so maybe there is more than one answer.

Step-by-step explanation:

An analyst surveyed the movie preferences of moviegoers of different ages. Here are the results about movie preference, collected from a random sample of 400 moviegoers.
A 4-column table with 4 rows. The columns are labeled age bracket and the rows are labeled type of movie. Column 1 has entries cartoon, action, horror, comedy. Column 2 is labeled children with entries 50, 22, 2, 24. Column 3 is labeled teens with entries 10, 45, 40, 64. Column 4 is labeled adults with entries 2, 48, 19, 74.
Suppose we randomly select one of these survey participants. Let C be the event that the participant is an adult. Let D be the event that the participant prefers comedies.
Complete the statements.
P(C ∩ D) =
P(C ∪ D) =
The probability that a randomly selected participant is an adult prefers comedies is symbolized by P(C ∩ D).

Answers

Using it's concept, it is found that the probabilities are given as follows:

P(C ∩ D) = 0.185.P(C ∪ D) = 0.5775.

What is a probability?

A probability is given by the number of desired outcomes divided by the number of total outcomes.

In this problem, there is a total of 400 moviegoers.

From the table, 74 are adults who prefer comedies, hence:

P(C ∩ D) = 74/400 = 0.185.

2 + 48 + 19 + 74 = 143 are adults, while 24 + 64 = 88 are not adults but prefer comedies, hence the "or probability" is given by:

P(C ∪ D) = (143 + 88)/400 = 0.5775.

More can be learned about probabilities at https://brainly.com/question/14398287

Answer:

0.3575

0.405

Step-by-step explanation:

A store owner discounted some silver coat racks from $625 to $405. What percentage is the discount?

Answers

Answer: 64.80% not 100% positive if i did that math right but thats what i got

Step-by-step explanation:

38.8679

Step-by-step explanation:

Please help :)

Chloe is an acrobat in a local circus. Her job is to move across a tightrope from point A to point B while blindfolded! She can only move using the distances that you tell her to move in your instructions. Chloe may go past the ladder. However, if she does, make sure she turns around and goes back toward the ladder.

Use the link: Link

Your Task: Work with your partner to find different combinations of the lengths given in parts (a) through (d) below that will allow Chloe to move from point A and end at point B (the end of the tightrope). You may use each length as many times as you like. .

1. For each crossing, look for at least three different ways to get the acrobat across. *Draw a diagram on your paper that shows the solution with the least amount of steps. *For the neither 2 write a number sentence/equation.​

Answers

Explanation:

We'll let you draw the diagram. Here are some possible equations. We have listed the shortest sequence first.

(a) 24 = (10 + 10 + 4) = (8 + 8 + 8) = (10 + 8 + 4 + 2)

(b) 17 = (10 + 3 + 2 + 2) = (10 + 3 + 3 + 3 - 2) = (3 + 3 + 3 + 3 + 3 + 2)

(c) 15 = (11 + 4) = (6 + 6 + 3) = (4 + 4 + 4 + 3)

(d) 27 = (19 + 8) = (19 + 12 - 4) = (19 + 12 + 4 - 8)

Which of the following

Answers

Answer:

which of the following what??

Step-by-step explanation:

..

Identify the dotted lines as an angle bisector, perpendicular bisector, or a median

Answers

Answer:

perpendicular bisectorangle bisectoraltitudemedian

Step-by-step explanation:

In each case, "how do you know" is answered by comparing the line to the definitions of the various types of lines.

1. perpendicular bisector --  a perpendicular segment that divides the base into two equal parts

__

2. angle bisector -- divides the vertex angle into two equal parts

__

3. altitude -- a line from the opposite vertex perpendicular to the side

__

4. median -- a line from the opposite vertex to the midpoint of the side

Other Questions
your parent had to go on an emergency work. Your kitchen was left uncleaned and they forgot to close the gas stove. Suddenly, the towel beside the gas stove is on fire. At your young age, what is the first thing you will do? how would you solve the problem? In a business environment, who is responsible for testing a website?. (1 x 3)+ (7 x 3) as a product of 2 factors What is the sum of the first 32 terms in the arithmeticseries 3 + 10 + 17 + ? What is m The french people supported napoleon bonaparte because they hoped he would: Given the graph below, write an equation in slope-intercept form. plumber what work in job In __________ ribosomes can attach to the mRNA and begin translation even though transcription has not been completed. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Is the graph increasing, decreasing, or constant?A. ConstantB. DecreasingC. Increasing Plant and animal cells are both eukaryotic. This means they...O Have a nucleusO Contain DNA and RNA.O Can reproduce on their own. in what year was the first aicpa conference on current sec developments held? what does the suffix ition mean in the word composition HELPPPPP PLSSSS WILL GIVE BRAINIEST!!!!! did thomas jefferson agree with the federalist papers? pls write a paragraph plssss Like the success of animals, the success of plants is limited based on the resources available to each individual. In the tropicalrainforest, plants are especially limited by the spate they have available to grow and reproduce. Which of these statementsdescribes a way that limited space will impactthe success of a plant in the rainforest? (SC.7.L.17.3)A plant without enough space will face increased predation from herbivoresaO A plant without enough space will not have as many parasites and diseases.3A plant without enough space will be more likely to be impacted by air qualityA plant without enough space will not be able to capture enough light to grow. Why do some atoms form chemical bonds while others do not? How did the Spanish-American war aid the U.S. in becoming a global power? Which is the best inference from the author's statement that world war ii ""ended the great depression""? the best inference from the author's statement is that. pleeeeease help meeeeeee