What is the answer to 7-x²

Answers

Answer 1

Answer:

7-1x^2

Step-by-step explanation:


Related Questions

What are the answers to these?

Answers

A) -3

B) 5

C) -2

D)-6

i have to write 20 characters so sisiasskklsa

Answer:

a) -3

b)5

c)-2

d)-6

Step-by-step explanation:

4 - 7 =-3

4 is positive and 7 is negative

a positive minus a negative is equal to a negative

3 is negative and 8 is positive, but 8 is bigger than 3, so take the sign of the bigger number which is 8.

c) is the same as question b

same signs rule

a negative + a negative is = to negative

positive and a positive is = to a positive

a negative +/_ a positive = a negative

Lin is playing hand ball and wants the ball
to bounce off wall CB and land at D.
Where on the wall should she aim if she's
standing at point A?

Answers

Lin should aim the ball at 7.8 feet away from point  B

From the question (see attachment), we have the following equivalent ratios:

[tex]AB : BE = DC :CE[/tex]

This is so because triangles ABE and DCE are similar triangles.

Such that:

[tex]BE + CE = 20[/tex]

[tex]AB = 16[/tex]

[tex]DC = 16 + 9 = 25[/tex]

So, we have:

[tex]AB : BE = DC :CE[/tex]

[tex]16 : BE = 25: CE[/tex]

Make CE the subject in [tex]BE + CE = 20[/tex]

[tex]CE=20 - BE[/tex]

Substitute 20 - BE for CE in [tex]16 : BE = 25: CE[/tex]

[tex]16 : BE = 25: 20 - BE[/tex]

Express as ratio

[tex]\frac{16 }{ BE} = \frac{25}{ 20 - BE}[/tex]

Cross multiply

[tex]16(20 - BE) = 25BE[/tex]

Open bracket

[tex]320 - 16BE = 25BE[/tex]

Collect like terms

[tex]25BE + 16BE = 320[/tex]

[tex]41BE = 320[/tex]

Divide both sides by 41

[tex]BE = 7.8[/tex]

Hence, she should aim at 7.8 feet away from point  B

Read more about similar triangles at:

https://brainly.com/question/14285697

Answer:You want to make a bank shot. Sketch the path of the cue ball so it will bounce off of the bottom side and knock the yellow stripe 9 ball into the top middle pocket.

Step-by-step explanation:

Need someone to help me with this

Answers

Y=3x+7
Formula- y=mx+b
B is y intercept
M is slope
Hope this helps!!

if the compound interest on a sum for 2 years at 4% p.a. is ₹408, then the simple interest on the same sum at the same rate and for the same period is (I) ₹400 (ii) ₹398 (iii) ₹200 (iv) ₹204​

Answers

Given that:

CI = ₹408

years = 2 years

Rate of interest = 4%

A = P{1+(R/100)}^

A-P = p{1+(R/100)}^n - P

I = P[1+(R/100)}^n - 1]

408 = P[{1+(4/100)²} - 1]

= P[{1+(1/25)²} - 1]

= P[(26/25)² - 1]

= P[(676/625) - 1]

= P[(676-625)/625]

408 = P(51/625)

P = 408*(625/51)

= 8*625 = 5000

Sum = 5000

Simple Interest (I) = (P*R)/100

= 5000*2*(4/100)

= 50*2*4 = 400

From the given above options, option (a) ₹400 is your correct answer.

Find the total surface area of this triangular prism
25 cm
24 cm
10 cm
14 cm

Answers

Answer:

Area = (Length * (a + a * (sin(Angle γ) / sin(Angle γ + Angle β)) + a * (sin(Angle β) / sin(Angle γ+Angle β)))) + a * ((a * sin(Angle γ)) / sin(Angle γ + Angle β)) * sin(Angle β)

this is for 8th grade pls answer .​

Answers

Step-by-step explanation:

We have that

[tex](x + \frac{1}{x} ) {}^{2} = 3[/tex]

We are trying to find the number value so that we can apply in the later equation.

Qe first simplify.

Remeber that

[tex](a + b) {}^{2} = a {}^{2} + 2ab + {b}^{2} [/tex]

Also remeber that

[tex] \frac{1}{x} = {x}^{ - 1} [/tex]

so

[tex](x + x {}^{ - 1} ) {}^{2} = {x}^{2} + 2x {}^{0} + {x}^{ - 2} = 3[/tex]

We then simply remeber that x^0=1 so

[tex] {x}^{2} + 2 + \frac{1}{ {x}^{2} } = 3[/tex]

Multiply both sides by x^2.

[tex] {x}^{4} + 2 {x}^{2} + 1 = 3 {x}^{2} [/tex]

Subtract both sides by 3x^2

[tex] {x}^{4} - {x}^{2} + 1 = 0[/tex]

Notice that x^4= (x^2)^2.

So our reformed equation is

[tex]( {x}^{2} ) {}^{2} - {x}^{2} + 1 = 0[/tex]

Let a variable , w equal x^2. This means that we subsitute variable, w in for x^2.

[tex]w {}^{2} - w + 1 = 0[/tex]

Now we use the quadratic formula

[tex] w = \frac{ - b + \sqrt{b {}^{2} - 4ac } }{2a} [/tex]

and

[tex]w = - b - \frac { \sqrt{b {}^{2} - 4ac } }{2a} [/tex]

Let a=1 b=-1 and c=1.

[tex]w = \frac{1 + \sqrt{1 - 4(1)} }{2} [/tex]

[tex]w = \frac{1 - \sqrt{1 - 4} }{2} [/tex]

Now, we get

[tex]w = \frac{1}{2} + \frac{i \sqrt{3} }{2} [/tex]

and

[tex]w = \frac{1}{2} - \frac{ i\sqrt{3} }{2} [/tex]

Now since we set both of these to the x^2 we solve for x.

and

[tex] {x}^{2} = \frac{1}{2} + \frac{i \sqrt{3} }{2} [/tex]

and

[tex] {x}^{2} = \frac{1}{2} - \frac{i \sqrt{3} }{2} [/tex]

We can represent both of these as complex number in the form of a+bi. Next we can convert this into trig form which is

[tex] {x}^{2} = 1( \cos(60) + i \: \sin(60) [/tex]

and

[tex] {x}^{2} = 1( \cos(300) + i \: sin(300))[/tex]

Next we take the sqr root of 1 which is 1, and divide the degree by two.

[tex] {x} = 1( \cos(30) + i \: sin \: 30)[/tex]

and

[tex]x = 1( \cos(150) + i \: sin(150)[/tex]

We are asked for the 2nd root so just add 180 degrees to this and we have

[tex]x = 1 \cos(210) + i \: sin \: 210)[/tex]

and

[tex]x = 1( \cos(330) + i \: sin(330)[/tex]

which both simplified to

[tex]x = - \frac{ \sqrt{3} }{2} - \frac{1}{2} i[/tex]

and

[tex]x = \frac{ \sqrt{3} }{2} - \frac{1}{2} i[/tex]

Now we must find

x^18+x^12+x^6+1.

We just use demovire Theorem. Which is a complex number raised to the nth root is

[tex] {r}^{n} (cos(nx) + i \: sin(nx)[/tex]

So let plug in our first root.

[tex]1( \cos(330 \times 18)) + i \: sin \: (330 \times 18))) + 1( \cos(12 \times 330)) + i \: sin(12 \times 330) + 1( \cos(6 \times 330) + i \: sin(6 \times 330))) + 1[/tex]

To save time we multiply the angle and use rules of terminals angle and we get

[tex]1( \cos(180) + i \sin(180) ) + 1( \cos(0) + i \: sin \:( 0) + 1( \cos(180) + i \: sin(180) + 1[/tex]

And we get

[tex] - 1 + 1 + - 1 + 1 = 0[/tex]

So one of the answer is x=0

And the other, let see

[tex]1 \cos(210 \times 18) + i \: \sin(210 \times 18) + 1 \: cos(210 \times 12) + i \: sin(210 \times 12) + 1 \cos(210 \times 6) + \:i sin(210 \times 6) + 1[/tex]

[tex] \cos(180) + i \: sin(180) + 1 \cos(0) + i\sin(0) +1( \cos(0) + i \sin(0) + 1[/tex]

We get

[tex] - 1 + 1 + 1 + 1 = 2[/tex]

So our answer are 2.

So the answer to the second part is

0 and 2.

how do you find the height of the base

Answers

Answer: the height of a triangle can be determined in many different ways depending on whether it's a right triangle, isosceles triangle (a triangle with two equal sides), or equilateral triangle.

Step-by-step explanation:

Step-by-step explanation:

The formula for the Area of a triangle is A = (1/2)bh where b is the base an h is the height. Since the triangle is a right triangle, the base and height are the two shorter sides

Find the equation of a line parallel to y = x + 8 that passes through the point
(-3,3).

Answers

Answer:

y=x + 6

Step-by-step explanation:

G1=G2

so G2 =1

y-3 /x+3 =1/1

y-3 = x +3

y=x + 6

2x^2
When x is equal to -3

Answers

Answer:

18

Step-by-step explanation:

Substitute x = - 3 into the expression

2x²

= 2(- 3)²

= 2 × 9

= 18

The graph of part of linear function g is shown on the grid.

Which inequality best represents the domain of the part shown?

Answers

Answer:

F

Step-by-step explanation:

open circle at (-9,3) means the symbol must be either < or >

closed circle at (2,-6) means the symbol must be either ≤ or ≥

the x-values of each ordered pair above represent the domain {-9 and 2}

What are the steps to convert a number from standard notation to scientific notation? ​

Answers

Answer:

Consider a big number 3,400,000. To convert this number into scientific notation:

Place a decimal by counting the steps to the left until the coefficient of the number is between 1 and 9.

Count the number of steps moved. This will be the power of the base 10.

In this case, the coefficient is 3.4 and the 6 steps are moved.

Multiply the coefficient by 106,

Therefore, the answer is 3. 4 x 10 6

Step-by-step explanation:

The temperature in Minnesota is 78 degrees at noon.

The temperature is 88 degrees by 4 pm. What is the

rate of change of the temperature from noon till 4?

Answers

16/4=4 is your answer

Identify the y-axis on the graph, what does it represent

Answers

Here, the y-axis represents different sports in which players are in.

Hope you could get an idea from here.

Doubt clarification - use comment section.

please help asap will give brainliest

Answers

Answer:

Step-by-step explanation:

11)  y = -1x - 2

12)  y = -(3/2)x + 3

13)  y = 3x - 2

14)  y = (3/4)x + 1

15)  y = (1/2)x + 1

16)  y = -(2/5)x

17)  y = 7x + 2

18)  y = (4/3)x - 4

Attached graph for 19 and 20

Use the graph to describe what transformation has taken place. List your answer below.

please help!

Answers

Answer:

reflection over the y axis

Step-by-step explanation:

The face of a clock is divided into 12 equal parts. The radius of the clock face is 10 inches. Assume the hands of the clock will form a central angle. The face of a clock is divided into 12 equal parts. Which statements about the clock are accurate? Select three options. The central angle formed when one hand points at 1 and the other hand points at 3 is 30°. The circumference of the clock is approximately 62. 8 inches. The minor arc measure when one hand points at 12 and the other hand points at 4 is 120°. The length of the major arc between 3 and 10 is approximately 31. 4 inches. The length of the minor arc between 6 and 7 is approximately 5. 2 inches.

Answers

The accurate statements are:

b. The circumference of the clock is approximately 62.8 inches. c. The minor arc measure when one hand points at 12 and the other hand points at 4 is 120°.  e. The length of the minor arc between 6 and 7 is approximately 5.2 inches.

The given parameters are:

[tex]n = 12[/tex] --- number of parts

[tex]r = 10[/tex] --- the radius

(a) The central angle

Between points 1 and 3, there are 2 sections, each of which has a measure of 30 degrees.

So, the measure of the two sections is:

[tex]\theta = 30^o \times 2[/tex]

[tex]\theta = 60^o[/tex]

Hence, (a) is false

(b) The circumference

This is calculated using:

[tex]C = 2\pi r[/tex]

So, we have:

[tex]C = 2 \times 3.14\times 10[/tex]

[tex]C = 62.8[/tex]

Hence, (b) is true

(c) The measure of the minor arc

Between points 12 and 4, there are 4 sections, each of which has a measure of 30 degrees.

So, the measure of the four sections is:

[tex]\theta = 30^o \times 4[/tex]

[tex]\theta = 120^o[/tex]

Hence, (c) is true

(d) The length of the major arc

Between points 3 and 10, there are 7 sections, each of which has a measure of 30 degrees.

So, the measure of the seven sections is:

[tex]\theta = 30^o \times 7[/tex]

[tex]\theta = 210^o[/tex]

The length of the arc is:

[tex]L = \frac{\theta}{360} \times 2\pi r[/tex]

So, we have:

[tex]L = \frac{210}{360} \times 2 \times 3.14 \times 10[/tex]

[tex]L = \frac{13188}{360}[/tex]

[tex]L = 36.3[/tex]

Hence, (d) is false

(e) The length of the minor arc

There is only one section between points 6 and 7

So, the measure of the section is:

[tex]\theta = 30^o[/tex]

The length of the arc is:

[tex]L = \frac{\theta}{360} \times 2\pi r[/tex]

So, we have:

[tex]L = \frac{30}{360} \times 2 \times 3.14 \times 10[/tex]

[tex]L = \frac{1884}{360}[/tex]

[tex]L = 5.2[/tex]

Hence, (e) is true

Read more about segments and arcs at:

https://brainly.com/question/14965059

Answer:

-B

-C

-E

Step-by-step explanation:

just took the test...

I got them right

will mark brainleist

Answers

Answer:

Figure a) 2

Figure B) 4

Figure c) 5

Step-by-step explanation:

Answer: A: has 1 line B has 2 and 3 has 5

Step-by-step explanation:

Multiplying radicals. Simplify

Answers

Answer:

9√10

Step-by-step explanation:

3√15 x 6  = √90

3√90 = 3 x √9 x √10

3 √90 = 3 x 3 √10 = 9√10

Acar moves at a constant speed of 50 miles per hour. How long
does it take the car to go 200 miles?
O 250 hours
150 hours
O 4 hours
O 10,000 hours

Answers

Answer:

4 hours · Speed = 50 mph · distance = time x speed · Time = 200 / 50 = 4 hours.

Step-by-step explanation:

evaluate f*ds where f = <3xy^2,3x^2y,z^3> and m is the surface of the sphere of radius 5 centered at the origin

Answers

The value of f.ds = 20π.

What is Flux?

The quantity of electric or magnetic field lines that flow across a surface in a specific period of time is known as flux. Field lines offer a way to visualise the size and direction of the field under study.

Given:

f = <3xy²,3x²y,z³>

Using Divergence Theorem

P= 3xy²

Q= 3x²y

R = z³

So, dP/ dx= 3y²

dQ/ dy = 3x²

dQ/ dz = 3z²

So, [tex]\int\limits\int\limits\int\limits dV[/tex]= [tex]\int\limits\int\limits\int\limits (dP/ dx + dQ/dy+ dR/dz)[/tex]

= [tex]\int\limits\int\limits\int\limits[/tex] (3y² + 3x² + 3z²)

= [tex]\int\limits\int\limits\int\limits[/tex] 3 (y² + x² + z²)

Since the radius is 5.

= [tex]\int\limits\int\limits\int\limits[/tex] 3(5)

= 15 [tex]\int\limits\int\limits\int\limits[/tex] dV

= 15 (4/3)π

= 20π

Learn more about flux here:

https://brainly.com/question/14527109

#SPJ5

enter an algebraic expression for the word expression.
2 decreased by n​

Answers

Answer:

2 - n

Step-by-step explanation:

2 decreased by n means n less than 2.

Answer:

Write each phrase as an algebraic expression. Phrase, Expression. nine increased by a number x, 9 + x. fourteen decreased by a number p, 14

Step-by-step explanation:

2-n       Plz mark brainliest if correct

Weston has $4,000 in his bank account and withdraws $30 a week. Evie has $2,800 in her
bank account and deposits $40 a week.

Answers

The week in which Evie would have more money than Weston is the 18th week.

Let this equation represent the amount of money Weston would have in x weeks be: $4000 - $30x

Let this equation represent the amount of money Evie would have in x weeks be: $2800 +$40x

The first step is to determine when they would have the same amount of money:

$4000 - $30x = $2800 +$40x

$4000 - $2800 = $40x + $30x

1200 = $70x

x = 1200 / 70 = 17.14 weeks

After 17 weeks, Evie would have more money than Weston.

Here is the complete question: Weston has $4,000 in his bank account and withdraws $30 a week. Evie has $2,800 in her  bank account and deposits $40 a week. When will Evie have more money than Weston (in

weeks)?

A similar question was answered here: https://brainly.com/question/25711114

GCF and LCM: word problems. Kiara is printing orange and green forms. She notices that 6 orange forms fit on a page, and 2 green forms fit on a page. If Kiara wants to print the exact same number of orange and green forms, what is the minimum number of each form that she could print? no links pls​

Answers

Answer:

6

Step-by-step explanation:

The LCM of 6 and 2 is 6.

The vertices of AXYZ are X(-4, 7), Y(0, 8), and Z (2, -1).

What are the vertices of r(180, 0) (AXYZ)?

"

Answers

Answer:

Step-by-step explanation:

i think it true if right mark me as brainiest and thank

Bonjour à tous, pouvez vous m'aider à trouver la réponse pour cette "question ouverte" svp?


Parmi les rectangles de périmètre 100cm, quelles sont les dimensions du rectangle d'aire maximale?

Merci d'avance, Joudy :))

Answers

La solution:

625 cm^2.

Explication étape par étape:

Si la forme est rectangulaire, elle aura la plus grande superficie possible quand la longueur équivaut à la largeur. Pour avoir un périmètre de 100 cm, cela signifie que chaque côté doit faire 25 cm.

La superficie serait alors de 25 cm x 25 cm = 625 cm^2.

Y - 7 =- 4(x - 2)

convert it into y-intercept form

Answers

Answer: the y intercept form is y= 4x-1

Step-by-step explanation: let me know if you need to know how I got it

WILL GIVE BRAINLEST


Robert is ordering jerseys for the baseball team

A local company charges $5,25 for each jersey and $45 to create the design

An online company charges $7.75 for each jersey and $20 to create the design

For which number of jerseys is the cost the same at both companies?

A)26 jerseys
B)1 jersey
С)5 jerseys
D)10 jerseys

Answers

Answer: D) 10 jerseys

Step-by-step explanation:

Let j represent the number of jerseys and C for total cost

Local company eqn: C = 5.25j + 45

Online company eqn: C = 7.75j + 20

Set both sides equal to solve:

5.25j + 45 = 7.75j + 20

5.25j - 7.75j = 20 -45

- 2.5j = -25

[tex]\frac{-2.5j}{-2.5}=\frac{-25}{-2.5}[/tex]

j = 10

Therefore, the cost is the same for both companies when 10 jerseys are sold

Please help with this question. I dont want another detention

Answers

Step-by-step explanation:

Total Students = 450 (Everything within the sample/rectangle)

Choir = 110

Band = 240

Both = 60 (Where both circles overlap)

110+240+60 = 410 (Total students in Choir or Band or Both)

410 ÷ 450 = 0.91111111

Therefore the probability that a student chosen at random is in the choir, band or both out of the sample is 91%

Answer =
410/450

60+110+240

hello how are you doing today

Answers

I am doing fine thanks bro.

If 2 of the triangle sides are 8 m and one side is 6 m what kind of triangle is it

Answers

Answer:

An isosceles triangle has two side lengths the same and one different.

Step-by-step explanation:

Other Questions
In a business environment, who is responsible for testing a website?. (1 x 3)+ (7 x 3) as a product of 2 factors What is the sum of the first 32 terms in the arithmeticseries 3 + 10 + 17 + ? What is m The french people supported napoleon bonaparte because they hoped he would: Given the graph below, write an equation in slope-intercept form. plumber what work in job In __________ ribosomes can attach to the mRNA and begin translation even though transcription has not been completed. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Is the graph increasing, decreasing, or constant?A. ConstantB. DecreasingC. Increasing Plant and animal cells are both eukaryotic. This means they...O Have a nucleusO Contain DNA and RNA.O Can reproduce on their own. in what year was the first aicpa conference on current sec developments held? what does the suffix ition mean in the word composition HELPPPPP PLSSSS WILL GIVE BRAINIEST!!!!! did thomas jefferson agree with the federalist papers? pls write a paragraph plssss Like the success of animals, the success of plants is limited based on the resources available to each individual. In the tropicalrainforest, plants are especially limited by the spate they have available to grow and reproduce. Which of these statementsdescribes a way that limited space will impactthe success of a plant in the rainforest? (SC.7.L.17.3)A plant without enough space will face increased predation from herbivoresaO A plant without enough space will not have as many parasites and diseases.3A plant without enough space will be more likely to be impacted by air qualityA plant without enough space will not be able to capture enough light to grow. Why do some atoms form chemical bonds while others do not? How did the Spanish-American war aid the U.S. in becoming a global power? Which is the best inference from the author's statement that world war ii ""ended the great depression""? the best inference from the author's statement is that. pleeeeease help meeeeeee perfectly competitive market in long run equilibrium. if demand decreases, we can be certain that price will