Which of the following has a generally positive connotation A.Snake B.Friend C.Travel D.Run

Answers

Answer 1
B. Friend.
Hope this helps!

Related Questions

Tap the word that them refers to

Answers

Answer:

Its the voices of the women I belive.

Explanation:

Answer:

Them is the Voices of the Native American women.

Explanation:

She started making poems to bring attention to the Native American women who were silenced.

Question *
Which is the correct punctuation ?

• Senator Schwartz I believe is the best
candidate, for the office.
• Senator Schwartz, I believe, is the best
candidate for the office.
•Senator Schwartz, I believe is the best
candidate for the office.
•Senator Schwartz I believe is the best
candidate for the office.
I’m giving brainliest to whoever answers :)

Answers

Answer:

The second option "Senator Schwartz, I believe, is the best

candidate for the office." is correct

Explanation:

Two commas are needed or else the sentence sounds wonky

id.k how to explain it just kinda read it aloud, pausing where there's a comma, and if it sounds weird it's probably the wrong answer

hope this helps chu <3

The second option is right

निम्नलिखित वाक्यों को Passive Voice में बदलिए-
(1) The peon is ringing the bell.
(2) She is washing her clothes.
(3) We are playing cricket
(4) Who is calling you there?
(5) Whom is he beating ?
(6) Ramesh is not drinking milk.
(7) Sakshi is singing a song.
(8) Father is reading the Ramayan.
(9) Why is he not learning his lesson ?
(10) Are you learning your lesson?​

Answers

Answer:

1. The bell is being rung by Peon

2. The clothes is being washed by her.

3. They are said to be playing cricket

4. He were asked who was calling him

5. He was asked who he was beating.

6. The milk is not being drunk by Ramesh

7. A song is being sang by Sakshi

8. The Ramayan is being read by father

9. He was asked why was not learning his lesson.

10. He was asked if he was learning his lesson

Explanation:

Active voice is defined as a subject acting on its verb in a sentence while passive voice is the subject of the sentence receiving the action.

Therefore, the given active voices above have been converted to passive voice.

how to use the mla format in writing a research paper​

Answers

Answer:

MLA Paper Formatting Basics

Use white 8 ½ x 11” paper

Make 1 inch margins on the top, bottom, and sides

The first word in every paragraph should be indented one half inch

Indent set-off quotations one inch from the left margin

Use any type of font that is easy to read, such as Times New Roman. Make sure that italics look different from the regular typeface.

Use 12 point size

Double space the entire research paper, even the works cited page

Leave one space after periods and other punctuation marks, unless your instructor tells you to leave two spaces

These guidelines come from the MLA Style Center’s web page “Formatting a Research Paper.”

MLA Guide Overview

There are various sections in this guide. Each section provides an in-depth overview of the different components to keep in mind when developing an MLA paper.

This guide includes the following sections:

Format background

The Header

General Paper Formatting

MLA heading format & Title page instructions

Running head & Page numbers

Quotations

Paraphrases

Punctuation

Abbreviations

Numbers (includes the use of numbers in MLA outline format)

Images, Tables, and Musical Scores

Lists

MLA works cited format

MLA citation format (for in-depth citation rules visit this MLA citation guide or MLA in-text citation guide)

Edits & Proofreading

hey guys! i'm writing a paper on synesthesia and i wanted to ask you this, what does the name:

Victoria

How does it Make you feel,sound, taste, or look like to you :)

Answers

Explanation:

it makes me feel regal. the name has an approach that makes it feel like royalty or has a superior power. Victoria is a latin word for victory so it gives a sense of peace and power

PLEASE HELP
Explain how using different sources could impact your inquiry.(1 point)

Using different sources can impact your inquiry by helping you to create multiple topics for research.

Using different sources can impact your inquiry by helping you to find multiple perspectives of others.

Using different sources can impact your inquiry by helping you to narrow the focus of your information.

Using different sources can impact your inquiry by helping you to change the focus of your questioning.

Answers

B it’s b CHOOSE B because it is b

Anthony begins her speech using the Preamble to the U.S. Constitution as

a. visible evidence
b. irrefutable fact
c. a tool to anger the audience
d. none of the above

Answers

answer:c






hope it helps

Read the passage on the left to answer the following questi 10) Which is the BEST statement of theme for this passage A) Believing in your abilities makes you stronger . B) A single person can produce real change ) Reading is the key to knowledge . D ) Always follow your dreams

Answers

Answer:

A

Explanation:

bcz it will support you to do work

Answer:

A

Explanation:

Read the excerpt from The Strange Case of Dr. Jekyll and Mr. Hyde.


It was a fine dry night; frost in the air; the streets as clean as a ballroom floor; the lamps, unshaken by any wind, drawing a regular pattern of light and shadow. By ten o’clock, when the shops were closed the by-street was very solitary and, in spite of the low growl of London from all round, very silent.


Which detail from the excerpt best establishes the gothic setting?


“fine dry night”

“ballroom floor”

“regular pattern”

“very solitary”

Posted it just to have it for other people it is D.Very solitary

Answers

fine dry night

Explanation:

how the night was

Read the excerpt from “The Girl Who Silenced the World for Five Minutes.”

In my life, I have dreamt of seeing the great herds of wild animals, jungles, and rain forests full of birds and butterflies, but now I wonder if they will even exist for my children to see.

Did you have to worry about these little things when you were my age?

Suzuki most likely asks this question to make her audience feel

disappointed.
ashamed.
helpless.
annoyed.

Answers

Disappointed and helpless. At least thats the feel I get. I hope that helps! Have a blessed day!

Answer:

A disappointed

Explanation:

English question ASAP​

Answers

Answer:

Third Option:

“I just had my car keys, but now I can’t find them anywhere. Has anyone seen my keys?”

Explanation:

First, the comma separates the now from the keys statement. This allows the sentence to flow more smoothly.

Second, the ”Has anyone seen my keys?” Is a question — in which it needs to be sepearated from a statement; “...but now I can’t find them anywhere.”

Answer:the third one is the correct answer

hope this helps!!

I need a story using the words Invidious, Providential, Affable, Indict, Confound, Sustain, Implement, and Formative can any one help.

Answers

Answer:

Sally put herself in an invidious position. It all stated when that storm hit. Thanks tot hat providential storm, school was closed. She hung out with her friend Britney, who is affable and easy to talk to. Everyone knows that Britney brother was indicted for fraud. But that doesn't mean that Britney is like her brother.  Her brother always told her to not be like him. "We must not confound ignorance with torpor of spirit or bluntness of understanding." he always said to her. They've always sustained an OK relationship.  Sally and Britney were outside building a snowman. They were just finishing implementing the top layer of the snowman, when John walked by. Their all still in their formative years, except john. John was 22 yrs old. John is Brittney's brother.

Explanation:

4. Which term best fits this
image?

A) Policy of Containment
B) Propaganda
C) Fear of the "end of the
world"
D) Military industrial complex

Answers

Answer:

A) Policy of Containment

If I right or wrong

Explanation:

How was your language grammatically correct and appropriate to the topic,
purpose, and audience? Give an example.

What kinds of hand gestures and facial expressions did you and other people use
to match what was being said?

How did you use eye contact, the volume of your voice, or other means to
connect with others during the discussion?

How well did the group solve problems and come to consensus?

Overall, how effective was the group discussion?

Answers

Answer:

What kinds of hand gestures and facial expressions did you and other people use  to match what was being said?

There are different types of hand  gestures and facial expressions. Some of them are adaptors, emblems, illustrators, disgust, anger, fear, sadness, happiness, surprise, contempt, etc...

Motion language or gestural language may allude to Sign language, dialects that utilization manual correspondence to pass on significance. Motion, real activities to discuss specific messages, with or instead of discourse.

They can assist you with highlighting individuals and things in your environment and makes intriguing to take note of our feelings. While, it may be certain or negative articulations. Outward appearances are a type of nonverbal correspondence.

They are an essential methods for passing on social data between people, yet they additionally happen in most different well evolved creatures and some other creature species. A hand Gesture is a type of nonverbal correspondence made with developments of the hands or an adjustment in body stance to express an inclination or thought.

How did you use eye contact, the volume of your voice, or other means to

connect with others during the discussion?

If you have direct eye contact with people during the discussion it will show that you are confident in your answer and people will also be confident in your answer. If you talk loud then people know that you're confident in your answer, but if you talk low then people will think that you aren't confident in your answer. If you have clear pronunciations then people will understand what you're saying. Lastly, if you have a good speaking rate then people will understand what you're saying and believe what you're saying.

How well did the group solve problems and come to consensus?

This will depend on how the group solve the problems and come to consensus.

Overall, how effective was the group discussion?

Here you explain how the group discussion really work out and the results.

Freee points

haha u thought, seriously help me pls
2.PART B: Which detail from the text best supports the answer to Part A?A“She completed degrees in biology in the United States before returning home to become the first woman in East and Central Africa to earn a doctorate.” ( Paragraph 3)B“Without it, their children were forced to eat foods that don't require cooking. This caused widespread malnutrition.” ( Paragraph 6)C“To give the baby trees a fighting chance, some children collected soda bottles from trash piles, filled them with water, turned them upside down, and planted them in the earth next to each seedling.” ( Paragraph 11)D“Green belts can be found in U.S. inner cities and Haiti. More than 30 million trees have been planted worldwide.” ( Paragraph 17)

Answers

Answer:

Its D

Explanation:

In paragraphs 11-19, the Earl allows cedric to help him get out of his chair. Why is this a significant event? Drag one explanation to the table below. Then drag two pieces of evidence that support this explanation.

Answers

Answer: On the first side, to the left the answer is THE EARL IS USALLY MEAN TO THOSE WHO ASSIST HIM. And on the other side it is “BUT HIS EVENING HE DID NOT SWEAR, THOUGH HIS GROUTY FOOT....” and its “USALLY THE FOOTMAN DID THIS, AND WAS VIOLENTLY SWORN AT WHEN HIS LORDSHIP....”

Explanation: Im taking this thing rn on I-Ready. Hope this helped

5. Her eyes were fireflies.
(2 puntos)
X metaphor
simile
hyperbole
Personification​

Answers

Answer:

hyperbole

Explanation:

hyperbole is something that is not to be taken literally so

(100 POINTS) Read the following statements.
1. It is common for people to make excuses for hateful humor.


2. Humor is always an important part of people's relationships.


3. It is not easy to tell the difference between good and bad humor.


4. People should not let others get away with telling hateful jokes.


Which two statements are MAIN ideas of the article?

Answers

Number 1 and 3 are the main ideas of the article because 2 and 4 are just information about sentences 1 and 3.

Hope this helps, have a great day!

As director of an organization to protect marine resources, Ben regularly advocates establishing a five-year ban on commercial fishing to help restore the population of key fish species to historical levels. Today, Ben is delivering his speech to members of a community where the fishing industry is the primary employer. What should Ben seek to achieve from the audience to today's speech

Answers

Group of answer choices.

a. partial change

b. wholesale change

c. negligible change

d. dramatic change

Answer:

a. partial change

Explanation:

A persuasive speech can be defined as a type of speech in which the aim or goals of the speaker is to convince the listeners (audience) to accept his or her own point of view, perspective, ideas or opinions. Thus, the main purpose of a persuasive speech is to inform an action in the minds of the potential listeners by accepting all or part of the ideas, views, or perception being expressed by the speaker.

In this scenario, as director of an organization to protect marine resources, Ben regularly advocates establishing a five-year ban on commercial fishing to help restore the population of key fish species to historical levels. Today, Ben is delivering his speech to members of a community where the fishing industry is the primary employer. Thus, Ben should seek to achieve a partial change from the audience through today's speech because the fishing industry is the primary employer of labor i.e it is the major industry that provides employment for the people living in the community.

This ultimately implies that, the allegiance of the people would be with the fishing industry and as such are less likely to totally agree with Ben's advocacy against commercial farming.

in 250 words write a descriptive composition about myself​

Answers

Answer:

hi my name is ____. im ___ years old i was born in the great city of ____.

in my spare time i can think of nothing better than sitting down on the couch grab a fluffy warm blanket turn of the lights and turn on some good old cartoons its an amazing escape from the real world. the only thing that is better thsn that is watching cartions and eating the best food in the word ___. the first time i ever tried ___ i just feel in love with the taste of the ___. some toher facts about my is my favorite color is ___. one of my favorite memorys is the second grade. the good old days. i rember waking up and getting ready to go on a feild trip. my best friend is ___ we would do like everything togther i remeber once whenver she ______.

Explanation:

some tips is talk about some toher memorys to finish off the essay like talk about your fave birthday and stuff like that and what makes you you

No one:

Me spamming the space bar for my laptop to turn on:...............................................................


FACE THE TRUTH, I KNOW YOU DO THIS

Answers

Answer:

YESSSSS

Explanation:

Answer:

Lol

Explanation:

Fill in the blank with the correct word or phrase.
meal comes with a bowl of
O The, soup
Thing
O An, soup
O An, the soup
O The, a soup​

Answers

Answer:

that makes no sense

Explanation:

Answer:

the l last one

Explanation:

cuz u cant say bowl of an soup

but bowl of the soup

or bowl of a sor

Based on the context of the except, what does the word protracted most clearly mean? answers in picture ​

Answers

Answer:

choice d

Explanation:

constructing for a long time if I'm wrong please tell me right away or tell me the answer so that I can also know.

Write 2 paragraphs that explain how Krimsky continues to structure his
essay to persuade readers of the vital role of free media within a democracy. How effective is this structure
in conveying Krimsky's ideas in a convincing way?

Answers

Answer:

explains how Krimsky continues to structure his essay to persuade readers of the vital role of free media within a democracy. How effective ..

Two examples of figurative language (type and meaning)

pls answer ​

Answers

Answer:

one is a simile - uses like and as in the sentence

Explanation:

the dog is so fluffy as a blanket

A biography:

A. facts of a person's life.
B. can be written using literary elements.
C. Both A and B.
D. None of the above

Answers

the answer is both A and B (C)

Why does each shopping bag have a different percentage written on it?

Not all items on sale are reduced by the same amount.

It is a way to trick customers into thinking they will save money.

Customers only shop if they know how much they will save.

The store may change the sale amount each day.
Picture of ad for End of Season Sale

Answers

That is how you make sales

Answer:

Not all items on sale are reduced by the same amount.

Explanation: I took the test before u can trust me

What is similar about the structures of the two articles about climate change?
Both describe different natural events that are affected.
Both use subheadings.
Both describe the steps in a research project.
Both have a glossary at the end.

Answers

Answer:

so the answer is A

Explanation:

hope this helps! :3

The similarity that exists between the structures of the two articles regarding climate change would be:

B). They both use subheadings.

Structure of Article

The structural similarity between the two articles is that 'they both employ subheadings. These subheads help in providing division to the articles and drawing the interest and attention of the readers. They promote better organization and comprehension for the readers to understand them.

Thus, option B is the correct answer.

Learn more about "Climate Change" here:

brainly.com/question/1365970

Expository, Narrative, Descriptive, and Persuasive/Argumentative are all types of ______________.

Answers

Answer:

Expository, Narrative, Descriptive, and Persuasive/Argumentative are all types of Essays.

Explanation:

- Eijiro <3

Answer:  Essays

explanation:

What are the Logan children doing at the beginning of Chapter 1

Answers

Answer:

The Logan children were walking to school.

Explanation:

Mildred D. Taylor's "Roll of Thunder, Hear My Cry" revolves around the Logan family, especially the children, amidst the racism issue. The novel deals with themes of discrimination, children's innocence infused with hilarious narration by the young protagonist, 9-year old Cassie Logan.

Chapter 1 starts with Cassie calling out to her brother, "Little Man, would you come on! You keep it up and you're gonna make us late." The Logan children- Stacey, Christopher-John, Clayton Chester "Little Man", and Cassie were walking along the dusty Mississippi road to get to their school, "Great Faith Elementary and Secondary School".

Other Questions
whats the answer to this plz help Consider the following figure. Elena is making chocolates. She starts by melting a block of chocolateshaped like a rectangular prism. Then she pours the melted chocolateinto molds shaped like rectangular prisms. How many chocolates canElena make with the block of chocolate? ????help me please #6thgrademath Over which interval does f(t) have positive average rate of change Please help me ASAP please do not put a link Hello. Any one has an idea for a photo that represent the situation we are living. I mean C-O-V-I-D style. Its for class. I will give brainliest A force of 20,000 N is exerted for 5.00 s, on a 75,000 kg mass. What is the impulse of the force for this 5.00 s ? Add a comma or semicolon if needed. Otherwise, submit the text without any additionalpunctuation.Keenan focuses his workouts on building strength and lean muscle mass _ to do so, heperforms a variety of exercises using the barbells and weight machines at the gym. the best answer it requests services, data and other resources available on the server What are the sins committed by Don Pedro and Don Diego against Don Juan? Radioactive decay occurs when the ____ decays Read the following sentence:Some kinds of water quality can be checked right in the stream or at the well.Which answer correctly uses domain-specific language to strengthen the writing? A)Some aspects of water quality can be determined directly in the stream or at the well.B)Some kinds of water quality can be figured out right in the stream or at the well.C)Some types of water quality can be tested right in the stream or at the well.D)Some aspects of water quality can be checked right in the stream or at the well. Please complete the following DNA strands1. AGGTCCAAGCTCAAATTTCCCC2. GAAACCCCTTAAACCTTAATTCC3. GCGCGCGCAAATTTTTCCCATCTPlease complete the following strands using RNA:1. AGGTCCCAAAGGCCCTTTCC2. UAAAGGGCCCAGCCCACC3. CUAAAAGGGGGUUUUAACC What is 1/12 cups converted into ounces? Match the countries and their aims after World War I.GermanyFranceItalyUnited Stateswanted to establish a lasting peace in Europewanted a treaty based on the armistice it had signedwanted territories near the Adriatic that Britain had earlier promisedwanted to punish and weaken Germany Plz, answer this question plz! Plz, answer this question plz! Plz, answer this question plz! Plz, answer this question plz! Plz, answer this question plz! I need help with these two questions Bob ate 1/3 loaf of bread over 4 days. He ate the same amount of bread each day. What fraction of the loaf did Bob eat each day? danielle did not complete 15 of her 200 assignments last year. Kim said that is 0.075 of her assignments and Kelly said it is 0.75 of her assignments. Who is correct and how do you know?