Your family has a total of 60 t-shirts and you decide to give some away. If 4 of the t-shirts are being worn right now, and there are 25 t-shirts left in the family's closets, how many t-shirts did your family give away?

Answers

Answer 1
You gave away 35 shirts. 60-25=35.
Answer 2

31

If you had 60 t-shirts and wore 4 and had 25 you do 25+4=29 then you do 60-29 that =31 so you will have sold 31 t-shirts


Related Questions

Write the following fraction as percent 7/10

Answers

the fraction version of 7/10 is 70% :))
7/10 is equal to 70%

Help help help help math math

Answers

Answer:

Oh It's Too Easy...

Step-by-step explanation:

By Pythagoras Theorem

a^2 + b^2 = c^2

7^2 + 5^2 = c^2

49 + 25 = c^2

74 = c^2

C = 74

Hopes that it will help u...

how many more seconds does it take to drive 1 mile at 40 miles per hour than 60 miles per hour​

Answers

Answer:

165 seconds

Step-by-step explanation:

If you were going steadily 60 miles per hour, you would go one mile in one minute. So, if you were going steadily 40 miles per hour, without your speed going up or down, you would get through one mile in 3 3/4 minutes (which is 165 seconds more than 1 minute).

Hope this helps. Pls give brainliest! Also, pls sub to kgirl633 on yt!

a storage tank is 60% filled with chemical solution. The storage tank holds 1,280 liters of chemical solution. How many liters of chemical solution are needed to fill the storage tank to the​ top?

Answers

Answer:

Step-by-step explanation:

write a proportion and cross multiply to solve for x

[tex]\frac{60}{100} = \frac{x}{1280}[/tex]

100x=76,800

x=768

60% full is 768 L. If the tank can hold 1,280 Liters, you need 512 more to fill it.

Alternatively...if the tank is 60% full, we need 40% more to fill it

[tex]\frac{40}{100} =\frac{x}{1280}[/tex]

100x=51,200

x=512 L

Given f(x) = x + 2, describe how setting k = 4 affects the slope and y-intercept of the graph of g compared to the graph of f.
g(x) = (4x) + 2
g(x)=4(x+2)

Answers

Answer:

g(2)=(4x) +2=7y

g(3)=4(x+2)

Josh and Adelina are staff members for a political candidate. They are considering hiring callers who will call
voters and ask for donations.
Josh and Adelina define X as the amount donated by a given voter they call. Based on data from their volunteer
callers, the expected value of X is E(X) = $18.07.
Adelina says, "For every 100 voters we call, we can expect to bring in about $1,807 in total donations."
Josh says, "If we call a very large number of voters, the average donation will be close to $18.07."
Whose statement is correct based on the expected value?

Answers

According to the given expected value, it is found that Josh's statement is correct.

The interpretation of the expected value is that over a large number of trials, the average value will be close to the expected value.

In this problem, the expected amount donated by a given voter they call is $18.07.

Hence, considering a very large number of voters called, the average amounts of their donations will be close to $18.07, hence, Josh's statement is correct.100 voters is not a large amount, hence the expected value should vary around $18.07, and we can't say that Adelina's statement is correct.

You can learn more about expected value at https://brainly.com/question/25858347

Answer:

both correct :)

Step-by-step explanation:

Select the correct answer. Find the intersection point for the following linear functions. f(x) = 2x + 3 g(x) = -4x − 27

Answers

Answer:

(-5,-7)

Step-by-step explanation:

Set functions equal to each other.

2x+3= -4x-27

2x+4x = -3-27

6x=-30

x= -5

f(-5) = 2(-5) +3

f(-5) =-10+3 y= - 7

g(-5) = -4(-5) -27

g(-5) =20-27 y= -7

x=-5 y=-7

(-5,-7)

Answer:

(-5,-7)

Step-by-step explanation:

PLEASE HELP WILL MARK BRAINIEST!!!!!!!

Answers

Answer:

Option a is the best method with compass and straight edge.

Step-by-step explanation:

What isa cookoo bird clock thingie mabob

Answers

Answer:

Step-by-step explanation:

yes that’s how it works

Create a storyline (word problem) for the real-world graph below.

(I can do the story part I just need the numbers)​

Answers

Answer:

Y would equal X on Day 65

Step-by-step explanation:

Im guessing by looking at the chart

Answer:

One line represents something getting heavier over time, while the line pointing down represents something getting lighter over time at a slightly slower rate.

A salesperson rent a car for a work trip. The rental car company charges the salesperson $25 each day and a flat fee of $100 for insurance.
If the salesperson is charged a total of $225 to rent the car for 2 days, which statement is true?
The equation 25% + 100 = 225 can be used to find 2, and the salesperson rents the car for exactly 2 days.
The equation 252 + 100 = 225 can be used to find z, and the salesperson rents the car for exactly 5 days.
The equation 100:1 + 25 = 225 can be used to find 2, and the salesperson rents the car for exactly 2 days.
O The equation 100.0 + 25
225 can be used to find, and the salesperson rents the car for exactly 5 days.

Answers

The true statement will be "the equation 25z + 100 = 225 can be used to find z, and the salesperson rents the car for exactly 5 days.

Let the number of days used to rent the car be z

If the rental car company charges the salesperson $25 each day, the total charges for "z" days will be $25z

If a flat fee of $100 for insurance is added and the salesperson is charged a total of $225 for "z" days, hence the required equation that represents this statement is expressed as:

Rental charges for "z" days  + $100 = total charge25z + 100 = 225

The true statement will be "the equation 25z + 100 = 225 can be used to find z, and the salesperson rents the car for exactly 5 days.

Learn more on functions here: https://brainly.com/question/17431959

Find the HCF of 150 and 250.

Answers

Answer:

It is 50

Step-by-step explanation:

Hope this helps

Answer:

50

Step-by-step explanation:

Fill in the blanks so the left side of each is a perfect square trinomial. That it complete the square

x^ 2 -2x+?=(x-?)^ 2

the question mark are the empty boxes for the numbers

Answers

Answer:

1

Step-by-step explanation:

Look at the LHS: you have the square of x, then you have 2 times x, times -1. to complete a square you just need to add the square of -1, that is 1. That becomes

[tex]x^2-2x +1 = (x-1)^2[/tex]

The dean of a business college in the Midwest claims that he can correctly identify whether a student is a finance major or a music industry management major by the way the student dresses. Suppose in actuality that he can correctly identify finance majors 84% of the time, while 16% of the time he mistakenly identifies a music industry management major as a finance major. Presented with one student and asked to identify the major of this student (who is either a finance or music industry management major), the dean considers this to be a hypothesis test with the null hypothesis being that the student is a finance major and the alternative that the student is a music industry management major. Which of the following statements illustrates a Type I error?

a. Saying that the student is a finance major when in fact the student is a music industry management major.
b. Saying that the student is a music industry management major when in fact the student is a music industry management major.
c. Saying that the student is a finance major when in fact the student is a finance major.
d. Saying that the student is a music industry management major when in fact the student is a finance major.

Answers

Using error concepts, it is found that the option that represents a Type I error is:

d. Saying that the student is a music industry management major when in fact the student is a finance major.

The definitions of each type of error are as follows:

A Type I error happens when a true null hypothesis is rejected. A Type II error happens when a false null hypothesis is not-rejected.

In this problem, the Hypothesis are:

Null: Student is a finance major.Alternative: Student is a music industry management major.

By the definition of a Type I error, in this problem, it would consist in saying that a finance major student is a music industry management major student, hence option d is correct.

You can learn more about Type I and II errors at https://brainly.com/question/25225353

a box contains 4 red balls and 6 purple balls. Ezra takes out a ball, puts it back and then takes out another ball. what is the probability that both balls were red

Answers

Answer:

16/100 = 4/25

Step-by-step explanation:

4/10 * 4/10 = 16/100

Help help help math math

Answers

Answer:

Function

Step-by-step explanation:

Hope it help !!

If sin ∅ = a/b then prove that (sec ∅ + tan ∅) = √b+a/b-a​

Answers

Given that

Sin θ = a/b

LHS = Sec θ + Tan θ

⇛(1/Cos θ) + (Sin θ/ Cos θ)

⇛(1+Sin θ)/Cos θ

We know that

Sin² A + Cos² A = 1

⇛Cos² A = 1-Sin² A

⇛Cos A =√(1-Sin² A)

LHS = (1+Sin θ)/√(1- Sin² θ)

⇛ LHS = {1+(a/b)}/√{1-(a/b)²}

= {(b+a)/b}/√(1-(a²/b²))

= {(b+a)/b}/√{(b²-a²)/b²}

= {(b+a)/b}/√{(b²-a²)/b}

= (b+a)/√(b²-a²)

= √{(b+a)(b+a)/(b²-a²)}

⇛ LHS = √{(b+a)(b+a)/(b+a)(b-a)}

Now, (x+y)(x-y) = x²-y²

Where ,

x = b and y = a

On cancelling (b+a) then

⇛LHS = √{(b+a)/(b-a)}

⇛RHS

⇛ LHS = RHS

Sec θ + Tan θ = √{(b+a)/(b-a)}

Hence, Proved.

Answer: If Sinθ=a/b then Secθ+Tanθ=√{(b+a)/(b-a)}.

also read similar questions:- i) sin^2 A sec^2 B + tan^2 B cos^2 A = sin^2A + tan²B..

https://brainly.com/question/12997785?referrer

Sec x -tan x sin x =1/secx Help me prove it..

https://brainly.com/question/20791199?referrer

Mary charges $5.60 per square foot of carpet, plus a $150 installation fee. How much should Mary charge the customer to the nearest cent?

Answers

Answer:

Step-by-step explanation:

Total = t

Square feet = f

t = 5.6f + 150

you didnt say how many square feet the customer wanted, but just plug it in for f and t is the answer

Answer:

375.30

Step-by-step explanation:

it's 375.302 but simplified to 375.30

Simplify 5(2x−1)+(−4x+8) . Write your answer in factored form.

please make it simple :)

Answers

Answer:

6x+3

Step-by-step explanation:

I hope this is what you where looking for

Sheila has $46 to buy graphing pads for her math class. Each pad costs $8.
How many pads can she buy? Do not include units in your answer.

Answers

Answer:

5

Step-by-step explanation:

If sheila has $46 to buy pads with, and each pad costs $8, then:

8 · 5 = 40

8 · 6 = 48

48 > 46,

So maximum amounts of pads she could is 5, and have remaining $6

Answer:

46÷8=5.75 so the answer is 5

What is the conjugate?
a - square root of a - 1

Answers

The conjugate of the expression a - square root of a - 1 is given as follows:

a + square root of a - 1

How to obtain the conjugate of an expression?

The conjugate of an expression is obtained for an expression that has two terms.

For the conjugate, we have that:

The signal of the first term is kept.The signal of the second term is inverted.

The expression is given as follows:

a - square root of a - 1

The parameters are given as follows:

First term of a.Second term of square root (a - 1).

Inverting the - sign to a + sign, the conjugate expression is given as follows:

a + square root of a - 1

More can be learned about the conjugate of a expression at https://brainly.com/question/1584140

#SPJ1

hellooo merry christmas !
can someone please help mee? ik its a lot but even just a little help would be very mich appreciated :))

Answers

Answer:

.....

Step-by-step explanation:

merry Christmas to you too

Plz I need help

























......................

Answers

Answer:

B. (0, -4) and (4, -4)

Step-by-step explanation:

The solutions are the points of intersection of the circle and the parabola.

(0, -4) and (4, -4)

A rectangular athletic field is twice as long as it is wide. If the perimeter of the athletic field is 90 yards, what are its dimensions?

Answers

Answer:

L=30 W=15

Step-by-step explanation:

90 divided by 6 is 15. 15 is the Width. Multiply 15 by 2 and you get 30 which is the Length.

pls help me . Eleven family members are going on a trip together. They have cars that fit only 4
people. How many cars will they need to take? help

Answers

Answer:

3.

Step-by-step explanation:

Since there are 11 family members and only 4 people fit in a car, they will have to take 3 cars.

4 x 3 = 12,

Also, even though there is going to be 1 seat extra you cannot squeeze 3 people in. Ps. (Just a safety note) In real life it is illegal to drive with extra passengers in a vehicle.

Hope that helps. x

Answer:

3

Step-by-step explanation:

3×4=12 so will still have one vacant seat on one of the cars

Find the value of x in the figure.

Answers

Answer:

64 degrees

Step-by-step explanation:

X equals 64 degrees because it shares a vertical angle pair with another angle which is 64 degrees. Since they are across from each other, x is 64 degrees.

Vertical angles are a pair of opposite angles formed by intersecting lines.

Which is equivalent to vg*
Og
O 78%
12784
8 4x

Answers

Answer:

  (c)  (12th root of 8)^x

Step-by-step explanation:

The applicable rules of exponents are ...

  [tex](a^b)^c=a^{bc}\\\\\sqrt[n]{a}=a^{1 \! /n}[/tex]

In this case, we have ...

  [tex](\sqrt[3]{8})^{x/4}=8^{1/3\cdot x/4}=8^{x/12}=\boxed{\left(\!\sqrt[12]{8}\right)^x}[/tex]

4. Calculate Karl Pearson's Coefficient of Correlation X 43 44 46 40 44 42 45 42 38 40 42 57. Y 29 31 19 18 19 27 27 29 41 30 26 10​

Answers

Answer:

Enter the following transactions into richard’s checkbook register and state his ending balance: date type description amount 03/01 check #204 blue sky apartments $455. 00 03/05 dep payroll automatic deposit $390. 36 03/08 debit benny’s hamburgers and fries $9. 20 03/15 check #205 car payment $251. 59 03/19 dep payroll automatic deposit $390. 36 a. $715. 79 b. $1,009. 81 c. $780. 72 d. $880. 24.

Loquan has 2 pieces of fabric, each measuring 3 & 1/4 feet long. How many feet of fabric does Loquan have in total?

Answers

Answer:

3+1/4= 3 1/4

Hope This Helps!!!

The total fabric which Loquan has is equal to 6.5 feet.

It is given that Loquan has 2 pieces of fabric . Each of the fabric is [tex]3\frac{1}{4}[/tex] feet long.

We have to find out the total fabric in feet which Loquan does have.

What will be the total length if there are two ropes of 1 meter each ?

The total length of the rope can be calculated by multiplying no. of ropes with length of one rope and that will be equal to 2 × 1 or 2 meter.

As per the question ;

Loquan has 2 pieces of fabric , each having length of  [tex]3\frac{1}{4}[/tex] feet

The total length of fabric can be calculated by multiplying 2 with

[tex]3\frac{1}{4}[/tex] feet.

i.e.,

2 ×  [tex]3\frac{1}{4}[/tex]

= 2 × [tex]\frac{13}{4}[/tex]

= [tex]\frac{13}{2}[/tex]

= 6.5 feet

Thus , the total fabric which Loquan has is equal to 6.5 feet.

To learn more about unitary methods click here ;

https://brainly.com/question/26700669

#SPJ2

what’s is the surface area of the tent if the length is 2 meters, the width is 2 meters, and the height is 3 meters?

Answers

Answer:

45 is the right answer

Step-by-step explanation:

Other Questions
Find the value of y. Will mark brainleist Find the percent markupA store advertises a 35% markdown on the PlayStation 5 gaming console. It normally sells for $1,019. what is the final sale price? Help asap pls!!! Put steps if possible 3 Question 6 of 40 What kind of account requires you to leave your money in it for a specific amount of time? A. Checking account B. Stock market account C. Savings account D. Money market account Next, use the table below to describe the historical context and significance of each event. Include information about how these eventsmay have impacted one another.progressive era event historical context and significance 1.2.3.4.5.6.7. What is x, the distance between points S' and S? x = 2.25 units x = 2.5 units x = 4.25 units x = 4.5 units Nepal is the beautiful garden. Prove it with suitable example How does the WHO prevent diseases and protect patients?by providing needy countries with low interest loansby facilitating trade that works to improve economiesby donating aid from one specific country to anotherby allowing organizations to collaborate with each other Which landform is formed when an oceanic crust and continental plate meet at a convergent plate margin your parent had to go on an emergency work. Your kitchen was left uncleaned and they forgot to close the gas stove. Suddenly, the towel beside the gas stove is on fire. At your young age, what is the first thing you will do? how would you solve the problem? In a business environment, who is responsible for testing a website?. (1 x 3)+ (7 x 3) as a product of 2 factors What is the sum of the first 32 terms in the arithmeticseries 3 + 10 + 17 + ? What is m The french people supported napoleon bonaparte because they hoped he would: Given the graph below, write an equation in slope-intercept form. plumber what work in job In __________ ribosomes can attach to the mRNA and begin translation even though transcription has not been completed. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT